Lentiviral vector construction
Green fluorescent protein (GFP) was carried by the lentiviral vector with a sequence that specifically silenced the STAT3 gene was constructed by GeneChem (Shanghai, China). The oligonucleotides were ligated to Hu6-MCS-Ubiquitin-IRES-puromycin (GeneChem, Shanghai, China) and have the following sequence: 5′- CAGCAGATGCTGGAACAGCAT -3′. A nontargeted sequence which have the following sequence: 5’-TTCTCCGAACGTGTCACGT-3’ was carried by a control lentiviral vector. The lentivirus (LV) particles were generated as described previously [11] with a final titer of 1×108 TU/mL.
NSC isolation and culture
NSCs were extracted from the brains of the fetuses of rats on the 14th, from pregnant Sprague-Dawley (SD) rats (Laboratory Animal Center of Sun Yat-sen University, Guangzhou, China) as previously described[12]. In short, the brain tissue is mechanically cut and removed in Hanks' balanced salt solution, and the cell suspension was centrifuged at 1,000 rpm for 5 min. The supernatant was discarded and diluting cell pellet into a single-cell suspension. NSCs were plated on a T25 culture flask (Corning, Acton, MA) containing Dulbecco’s modified Eagle’s medium/F-12 nutrient mixture, 1% l-glutamine (Gibco, Grand Island, NY, USA), 2% B27, 1% penicillin/streptomycin, 20 ng/mL fibroblast growth factor-2 (FGF-2) and 20 ng/mL epidermal growth factor (EGF) (Peprotech, Rocky Hill, NJ). NSCs were cultured in 5% CO2 at 37 °C and passaged by weekly by digesting with Accutase (Millipore, Bedford, MA) in the medium mentioned above. 2nd to 4th passage NSCs were used in the following experiments in this study .
NSC transfection
For cell transfection, 2nd passage neurospheres were dissociated into a single-cell suspension at a density of 1×105 cells/ml and plated on coverslips coated with 0.01% poly-L-lysine (Sigma, Germany) in 12 multiwell plates (Corning, NY, USA). The cells were then kept restored in the culture medium and divided into three groups : the control group(CL), control RNAi group (LV-CL), and STAT3 RNAi (LV-STAT3) group, each group received different treatments the next day: control culture, control RNAi LV, and STAT3 RNAi LV respectively. The medium was then changed to fresh medium after 24 h. After 72 h of transfection, GFP expression was visualized by fluorescence microscopy (Carl Zeiss Axio Observer Z1). To quantify the suppress effects of RNAi on STAT3 gene, STAT3 expression in each group was examined by real-time PCR (RT-PCR) and Western blot analysis.
Western blot
Protein lysates were extracted from the cells (N=5 per group, harvested at 3 d after transfection). Bicinchoninic acid assay (Beyotime Biotechnology) was used to measure the protein concentration and the protein was equilibrated before loading. Protein samples in each group were separated by SDS-PAGE (10% Bis-Tris gel), transferred to a PVDF membrane (Millipore, Bedford, USA) and blocked with 5% BSA (Sigma, Germany) for 1 h, followed by incubation with primary antibodies at 4 °C overnight. Primary antibodies targeting STAT3 (Abcam, USA), phosphorylated STAT3 (p-STAT3, CST, USA), mTOR (CST, USA), phosphorylated mTOR (p-mTOR, CST, USA) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH; CST, USA) were used at 1:1,000 dilution. After washing the membranes in TBST (Tris-HCl buffer containing 0.2% Tween 20, pH 7.5) twice, the membranes were incubated with a filtered and peroxidase-conjugated secondary antibody for 1 h at room temperature and then washed three times in TBST. Finally, the results were observed by enhanced chemiluminescence (ECL) development system (Millibo, USA).
RNA extraction and RT-PCR
Total cells RNA (N=5 per group, harvested at 3 d after transfection) were extracted using TRI reagent (Molecular Research Center, Cincinnati, OH). RNA was reverse transcribed into cDNA by using a reverse transcription system (Promega, Madison, WI). Real-time PCR was performed on an ABI 7900 PCR detection system (Applied Biosystems, Foster City, CA) using SYBR Green PCR Master Mix (Applied Biosystems). Parallel amplification of the GAPDH housekeeping gene was used to normalize gene expression. PCR primer sequences are listed below: STAT3 forward primer: AATATAGCCGATTCCTGCAAGAG, reverse primer: TGGCTTCTCAAGATACCTGCTC. GAPDH forward primer: TGACGCTGGGGCTGG CATTG, reverse primer: GGCTGGTGGTCCAGGGGTCT. The relative expression level of target mRNA was calculated using the ΔΔCt method.
Surgical procedures and cell transplantation
All experimental animal procedures have been approved by the Care and Use Committee of Sun Yat-sen University (ethics number: SYXX2012-0081) and performed in accordance with the Guide to the Care and Use of Experimental Animals provided by the National Research Council (1996, USA). All the animals were housed three to a cage with free access to food/water and kept under standardized atmosphere (temperature: 22°C, humidity: 55%, 12/12 h cycle).
Spinal cord surgery was performed on 60 adult female SD rats (200–250 g) which were bought from Sun Yat-sen University .All the rats were healthy and without previous procedures. The rats were randomly divided into four groups, including the sham group (spinal cord exposure only, n=10), the SCI group (n=15), the STAT3-shRNA-treated NSC group (LS group, n=20) and the control-shRNA-treated NSC group (LC group, n=15). In the SHAM group, rats were undergone surgery but without transection of the spinal cord; In the SCI group, rats were undergone surgery with complete transection of the spinal cord; in the LC group, rats were undergone surgery with complete transection of the spinal cord and then NSCs with transfected with control lentiviral vectors were injected into at a depth of 1 mm rostral and caudal to the injured site using a microsyringe ; in the LS group, rats were undergone surgery with complete transection of the spinal cord and then NSCs with transfected with STAT3 lentiviral vectors were injected as mentioned above . As previously described[13], briefly, animals were anesthetized with 1% pentobarbital sodium (40-45 mg/kg) by intraperitoneal injection. Laminectomy was performed at the level of the 10th thoracic vertebra (T10). Next, the spinal cord was cut twice by using scissors (once caudal to T10 and once rostral to T10) for complete transection, then a 2-mm block of the spinal cord was removed. After hemostasis, the rats were injected with 5 μL of cells (control-shRNA-treated or STAT3-shRNA-treated NSCs at a density of 1 × 105 cells/μL) at a depth of 1 mm rostral and caudal to the injured site by using a microsyringe at a rate of 0.5 μL/min. Finally, 5–0 sutures were used to suture the muscle and skin and daily intraperitoneally injected 1 mL of saline containing 1 ×105 units of penicillin for 1 week to prevent infection and dehydration. Postsurgical care of SCI rats included manual bladder expression twice a day until bladder function was restored. Surgery was performed in a blinded manner. After 8 weeks of surgery, rats were euthanized by anesthesia with 1% pentobarbital sodium (40-45 mg/kg) and then sacrificed by CO2 asphyxiation, and the spinal cord was collected at -80 °C or for perfusion.
Basso-Beattie-Bresnahan test
The Basso, Beattie, Bresnahan (BBB) locomotor rating scale is considered a reliable tool for evaluating impairment and recovery of motor abilities in hindlimbs after spinal cord injury [14]. A total score of 21 points indicates that locomotors ability is not affected . Rats were placed in an open experimental field and allowed to move freely for 5 min, and the crawling ability was assessed by the BBB scale. Hindlimb motor behavior was evaluated weekly for 8 weeks, with tests carried out the same time each day and grading performed by two investigators blinded to grouping.
Spinal cord-evoked potential (SCEP) recording
At 8 weeks post injury, 20 rats (n = 5 in each group) were anesthetized with 1% pentobarbital sodium (40-45 mg/kg) and stereotaxically fixed. Then, the T5-L1 vertebrae were completely exposed. Summarily, a stimulation electrode was inserted into the T5-T6 interspinous ligaments, after that a pair of needle electrodes was inserted into the interspinous ligaments of T12-L1 for SCEP recording. The electrodes were connected to a BL-410E Data Acquisition Analysis System for Life Science (Chengdu, China). The parameters of the SCEP signals were set as follows: gain of 2,000, time constant of 0.01 s, and filtering at 300 Hz. To elicit an SCEP, a single-pulse stimulation (50 ms in duration at a frequency of 5.1 Hz and a voltage increase of 1 mV) was transmitted through the electrodes until a mild twitch of the vertebral body of the animal was observed. To obtain high-quality waveforms for the SCEP signals, we had averaged 100 SCEP responses per rat.
Perfusion and cryosection
Eight weeks after spinal cord surgery, rats were submitted to anesthesia with 1% pentobarbital sodium (40-45 mg/kg) and sacrificed by CO2 asphyxiation. Rats were then perfused transcardially with 0.9% normal saline and 400 mL 4% paraformaldehyde (PFA). T8-L1 segments of the spinal cord were postfixed with 4% PFA overnight and transferred to 30% sucrose for cryoprotection for 2-3 d at 4 °C after collection. Then, embedded tissues were sliced transversely or longitudinally at a thickness of 10 μm, mounted on polylysine-coated glass slides, and stored at −20 °C preparing for next experiments.
Histopathological analyses
To assess the cavity area of the spinal cord, we sacrificed rats (N =5 per group) for hematoxylin-eosin (H&E) staining at 8 weeks after SCI. T8-T11 longitudinal spinal cord sections from each group were stained with H&E following standard protocols and observed in a bright field. The cavity area of these images was evaluated using NIH ImageJ software (Wayne Rasband, National Institutes of Health, Bethesda, MD). For neuron examination, transverse sections of the tissue surrounding the injured site were submitted to Nissl staining (Beyotime, Shanghai, China, C0117).
Fluorescent immunohistochemistry
Tissue sections from rats or cells (N=5 per group) were fixed in 4% PFA for 30 min and permeabilized with 0.3% Triton X-100 for 30 min. Blocking was performed with 5% normal goat serum for 1 h, and tissue sections were incubated with primary antibodies targeting the following proteins at 4 °C overnight: β3-tubulin (1:200, CST,USA), GFAP (1:300, CST,USA), and microtubule-associated protein 2 (MAP2; 1:200, CST,USA). ProLong Gold antifade reagent containing 4′-6-diamidino-2-phenylindole (DAPI) (Thermo Fisher,USA) was used for nuclear staining. Then, the total area of target marker-positive cells was evaluated in each visual field under fluorescence (Carl Zeiss Axio Observer Z1, Germany) with ImageJ software. Five random fields in each section and five sections per group were examined independently by 2 observers blinded to grouping.
Retrograde axonal tract tracing
Animals (N = 5 per group) were submitted for neurons retrograde tracing by Fluorogold (FG, 1:25, Santa Cruz, CA, sc-358883) at 7 weeks after SCI. Briefly, a dorsal laminectomy was performed at T12, and 0.5 μl of FG was injected into the spinal cord by using a microsyringe. At 1 week after injection, the animals were perfused, and the T8 segment of the spinal cord was collected to detect FG-labeled neurons.[15].
Statistical Analysis
All statistical analyses were performed using GraphPad Prism 6 software (GraphPad Software, La Jolla, CA). All data in the study were first used Shapiro-Wilk test to evaluated normality .All data were then expressed as the mean ± SD and were analyzed via one-way analysis of variance followed by Bonferroni post hoc tests for multiple comparisons or Student t test for pairwise comparisons. P<0.05 indicated statistical significance.