Animal experiment protocols
Male BALB/c mice (8 weeks old) were purchased from Japan CLEA Co. (Tokyo, Japan). They were housed at a constant room temperature of 22℃ ± 1℃ under a controlled 12 h light/12 h dark cycle and had free access to water and regular chow. The mice were intravenously injected with a vehicle (normal saline; n = 12) or 11 mg/kg of ADR (n = 24) Santa Cruz Biotechnology Inc., Dallas, TX, USA) on day 0.23 Twenty mice treated with normal saline were assigned to the non-FSGS control (Cont) group. The ADR-treated mice were randomly assigned to two groups (12 per group) as follows: those treated with vehicle (normal saline; ADR group) and those treated with NMN (500 mg/kg/day) in normal saline (NMN 500 group). The animals were treated every day for 14 consecutive days from day 0 to day 14, as described previously.22 The survival of the animals was examined every day, and the body weights were estimated every week. Urine samples were collected on days 14 and 28. Serum samples measuring the cholesterol and creatinine levels were collected on days 14 and 28. The kidneys of the animals were harvested to assess the renal histology on day 14 (just after completing the NMN treatment) and day 28 (2 weeks after treatment termination). All the animal studies were approved by the Animal Care Committee and the Ethics Committe of the Tokushima University School of Medicine and study was carried out according to the national and regional guidelines. All the studies are reported in accordance with ARRIVE guidelines.
Blood and urine examination
Urine was collected for 24 h from metabolic cages, and the renal function was evaluated based on the serum creatinine levels and creatinine clearance (Ccr). The Ccr was calculated using the following formula: urinary creatinine × urine volume/serum creatinine/1,440, where 1440 represents the number of minutes in 24 h. Albuminuria was assessed based on the urine albumin to creatinine ratio (ACR). The urine albumin level was assessed by an enzyme-linked immunosorbent assay (ELISA; Albuwell M; Ethos Biosciences, Pennsylvania, USA). The urine and serum creatinine levels were assessed using the QuantiChrom™ Creatinine Assay Kit (BioAssay Systems, California, USA). Serum cholesterol levels were measured with a mouse cholesterol ELISA Kit (Abcam, ab285242).
Histology and immunohistochemistry of the kidney
Images from at least 20 sequential glomerular cross-sections divided approximately at the glomerular equator were collected for each histological section by blinded observers. PAS-stained samples from 20 consecutive glomeruli per animal were examined. The glomerular surface area was traced along the outline of the capillary loop using Image-Pro Plus 7.0J software (Media Cybernetics, Silver Spring, MD, USA). For the quantitative analysis of the mesangial expansion, the PAS-positive area in the glomeruli was evaluated. Specifically, a minimum hue–saturation–intensity threshold was set on Image-Pro Plus 7.0J (Media Cybernetics), and the area exceeding this threshold was counted as a PAS-positive area. Consequently, the percentage of PAS-positive area per glomeruli was calculated. IHC was performed as described previously.3 Briefly, paraffin sections (4 mm) were fixed in 3% formaldehyde and stained with the primary antibodies for Claudin-1 (Invitrogen, 51-9000, 1:50), Sirt1 (Sigma-Aldrich, 07-131, 1:100), Synaptopodin (Fitzgerald, 10R-S125A, undiluted), WT-1 (Santa Cruz, C-19, 1:200), Nampt (Bethyl Laboratories, A300-372A, 1:500), Nmnat1 (Proteintech, 11399-1AP, 1:500), Sirt3 (Cell Signaling, C73E3, 1:50), Sirt6 (LSBio, aa250-334, 1:2500), DNMT1 (Cell Signaling Technology, #5032, 1:100), PARP1 (Proteintech, 13371-1-AP, 1:200), Twist2 (Abcam, ab66031, 1:200), and H3K9me2 (Abcam; mAbcam 1220, 1:200). Goat antirabbit IgG (Nichirei, 414341) and goat antimouse IgG (Nichirei, 414321) antibodies were used as the secondary antibodies. All sections were examined under a light microscope (Olympus BX53 microscope) and digitized with a high-resolution camera. For the quantitative analysis of the staining for Sirt1, Claudin-1, Synaptopodin, Sirt3, Sirt6, H3K9me2, and DNMT1, the DAB-stained area per glomerular surface area was calculated using Image-Pro Plus 7.0J. The Definiens Tissue Studio software (Definiens, Munich, Germany) was used to calculate the DAB-stained area per section per kidney for the quantitative analysis of the Nampt, Nmnat1, PARP1, and Twist2 immunostaining. All assessments were performed in a blinded manner, and four kidneys were examined in each group.
Electron microscopy
For the electron microscopy (EM) evaluation, the kidney tissues were harvested and fixed overnight at 4℃ with 2% paraformaldehyde and 2% glutaraldehyde (GA) in 0.1 M phosphate buffer (PB; pH 7.4). After fixation, the samples were washed three times with 0.1 M PB for 30 min each and post-fixed with 2% osmium tetroxide (OsO4) in 0.1 M PB at 4℃ for 2 h. The fixed tissue blocks were embedded in Epon epoxy resin. The average number of podocyte foot processes was counted and divided by the glomerular basement membrane (GBM) length (mm) to determine the densities of the foot processes as described previously22. The counts were performed on 105 micrographs from at least three glomeruli in each mouse. Using Image-Pro Plus 7.0J, the length and thickness of the GBM were measured.
NAD+ metabolite measurement
Levels of NAD+ metabolites were measured using LC/MS/MS as described previously3 with minor modifications. Briefly, three volumes of methanol containing 6% perchloric acid and 4% phosphoric acid were used to homogenize the tissues. Subsequently, three volumes of methanol (including the deuterated internal standard) were added to the tissue homogenate or in serum samples; this mixture was vortexed and centrifuged. The supernatant was diluted with water and LC/MS/MS was used to analyze it. The Shimadzu Nexera UHPLC system (Shimadzu, Kyoto, Japan)—consisting of an LC-30 AD pump, a DGU-20A5R degasser, a CTO-20AC column oven, and a SIL-30ACMP autosampler—was used. At 50°C, separation was carried out using a Triart C18 column (3.0 150 mm, 5 m, YMC, Kyoto, Japan). Mobile phase A included water/formic acid/undecafluorohexanoic acid (1000/0.1/0.2, v/v/v), and mobile phase B included methanol. The chromatographic conditions were 0–4 min (5%–80% B, 0.5 mL/min), 4–4.01 min (80%–95% B, 0.5–1.0 mL/min), 4.01–7 min (95% B, 1.0 mL/min), 7–7.01 min (95%–5% B, 1.0–0.5 mL/min), and 7.01–13 min (5% B, 0.5 mL/min). An API5000 triple quadrupole mass spectrometer (SCIEX, Framingham, MA, USA) with electrospray ionization (ESI) in the positive ion mode was used for mass spectrometric detection. Standard solutions were used to optimize the ESI-MS/MS settings for each analyte. Quantitation was performed using multiple reaction monitoring with the following transitions: m/z 123 → 80 for NAM, m/z 335 → 123 for NMN, and m/z 664 →136 for NAD+.
Nmnat1 CpG methylation in vitro by methylation-specific polymerase chain reaction (MSP) and real-time MSP
Total genomic DNA from cultured podocytes was extracted using the DNeasy Kit (Qiagen Japan, Tokyo, Japan). Bisulfite conversion of genomic DNA was performed using a Zymo EZ DNA Methylation Gold kit (Zymo Research Corp., Orange, CA, USA). MSP was performed to determine the methylation status of the Nmnat1 gene and real-time MSP was performed to quantitatively analyze the methylation of the gene, as described previously.24 Supplementary table 1 lists the specific methylated or unmethylated sequences of the primer sets. Three independent MSPs and real-time MSPs were performed.
Luciferase assay
A 1414-bp fragment (−1413 to +1) of the 5′ flanking region of Nmnat1 was isolated from the murine BAC genomic clone using the restriction endonucleases BalI and EcoT14I. Plasmids −1158, −866, −622, and −305 Luc were prepared by subcloning the BglI, ClaI, HindIII, and ScaI inserts from −1413 Luc. These Nmnat1/pGL3 plasmids (−1413 Luc, −1158 Luc, −866 Luc, −622 Luc, and −305 Luc) containing the murine Nmnat1 promoter sequences between −1413, −1158, −866, −622, and −305 and +1 were fused to a pGL3 vector, a firefly luciferase reporter plasmid, and then transfected with Lipofectamine 2000 (Invitrogen). NMN and ADR were added and pRL-CMV (Renilla luciferase reporter vector; Promega, Madison, WI, USA) was cotransfected into the cells. Murine podocyte cells have been described previously.5 Podocyte cells were treated with 0.2 μg/ml of ADR in a regular medium, and the medium was harvested at 24 h after treatment. The luciferase activity was measured as described previously.24 The mutagenesis primers were generated from the −866 luciferase reporter plasmid by mutating CAGCTGA to CCCTTTA using in vitro mutagenesis.
Culture of podocytes
Conditionally immortalized mouse podocytes were donated by P. Mundel (Mt. Sinai School of Medicine, New York, NY, USA) and K. Asanuma (Chiba University, Chiba, Japan). The podocytes were seeded at a density of 5 × 105 per 100 mm2, incubated for 7 days (differentiation), and used for further experiments. The differentiation of the cells was confirmed as described previously.5 The cells were treated with 5 μM 5-aza-dC (Sigma-Aldrich) for 96 h. For the Dnmt siRNA treatment, a Dnmt siRNA duplex was purchased from Sigma-Aldrich. The sense sequences were 5′-[dT] GGAAUGGCAGAUGCCAACAGC [dT]-3′ for Dnmt1, 5′-[dT] GAAAGCGAAGGUCAUUGCA [dT]-3′ for Dnmt3a and 5′-[dT] GCUAGCGAAGGUCAUUGCA [dT]-3′ for Dnmt3b. The control siRNA consisted of a scrambled siRNA construct encoding a nonspecific siRNA without mammalian homology. These siRNAs (100 pmol μl−1) were transfected using Lipofectamine 2000 (Invitrogen) for 24 h.
Statistical analyses
GraphPad Prism 8 software (GraphPad Software, CA, USA) was used to perform the statistical analyses. Data are expressed as means ± standard error of the mean. Comparisons among several groups were analyzed using a one-way analysis of variance and Tukey’s post hoc test. A P-value of <0.05 was considered statistically significant.