Plant materials and growth conditions
Arabidopsis thaliana, ecotype Columbia (Col-0) was used throughout this study. For vernalization, wild-type and mutant seeds were treated in the 0.5 ´ Murashige and Skoog (1/2 MS) medium [29] containing 1% (w/v) sucrose, and 0.6% (w/v) phytoagar in the dark at 4℃ for 3 days before germination. Plants were grown on 1/2 MS agar plates in a growth chamber at 23℃ under long day conditions (LD, 16 h light/8 h dark photoperiod) or under short day conditions (SD, 8 h light/16 h dark photoperiod). The light intensity was approximately 100 mmol m-2 s-1.
Construction of vectors and the generation of AtGATA25 overexpression transgenic plants
To generate the overexpression of AtGATA25 (At4g24470) transgenic plants, full-length GATA25 CDS was amplified from leaf cDNA of Arabidopsis by PCR using primers linked to SpeI and XmaI sites (shown in lower-case letters): 5’- GGactagtATGTTTGGTCGCCATTC -3’ (forward) and 5’- CCCcccgggTTAGTGATCACCTAAC -3’(reverse). The PCR product was cloned into a homemade binary pTK-BMLC vector [30, 31]. The vector construct used in this study was verified by the Sanger sequencing.
The pTK-BMLC binary vector was transformed into the Agrobacterium tumefaciens strain GV3101 used for Agrobacterium-mediated transformation of Arabidopsis thaliana (Col-0) [32]. Briefly, a single A. tumefaciens (GV3101) containing the pTK-BMLC binary vector construct was cultured to a final OD600nm of 0.8 and then suspended in a floral dip inoculation medium containing 5% (w/v) sucrose and 0.05% (w/v) Silwet L-77 (Lehel Seeds, Round Rock, TX, USA). The floral dip inoculation medium was used for the transformation of Arabidopsis thaliana, and transgenic plants were screened using a 0.1% Basta solution as a selection marker.
Design the common gRNA target sequence and CRISPR/Cas9 vector construction
The sequence of AtGATA25 (At4g24470) was obtained from the Arabidopsis Biological Resource Center (TAIR). Sequence analysis of AtGATA25 genes was conducted using the web tools of CRISPR-P version 2.0 online software (http://crispr.hzau.edu.cn/CRISPR2/) [33]. The common gRNA target sequence was selected in the second exon of AtGATA25 (GCCTCCGATTTGATTCCCGATGG; the PAM sequence is underlined).
To construct sgRNA modules for gene editing in Arabidopsis, we used the pKSE401 vector which is the CRISPR/Cas9 plant expression vector. The vector was constructed by modifying the previously described method [34]. Briefly, equal volumes of 100 mmol/ml AtGATA25 gRNA_F (attgGCCTCCGATTTGATTCCCGA) and AtGATA25 gRNA_R (aaacTCGGGAATCAAATCGGAGGC) were mixed and incubated for 5 min at 95℃ and then slowly cooled at 25℃ to produce a double-stranded insert with 4 nucleotide 5’ overhangs. The assembled gRNA as a double-stranded insert was inserted into the pKSE401 vector by following the Golden Gate Assembly [35], using BsaI and T4 Ligase (NEB, Ipswich, MA, USA).
Generation of CRISPR/Cas9-mediated transgenic plants and selection of transgenic plants from T0 plants
For the generation of gata25 mutant, the CRISPR/Cas9 binary vector construct was introduced into the Agrobacterium tumefaciens strain GV3101 and used by following a modified floral dip method [32].
All the collected candidate transgenic seeds were grown on a medium containing kanamycin (50 mg/ml) to select T1 generation of transgenic plants (T1 plants) from T0 generation of transgenic plants (T0 plants) [36]. Briefly, the collected T0 seeds were sterilized by 70% (v/v) ethanol for 1 min, followed by seed disinfectant (25% (v/v) bleach and 0.01% (v/v) Triton X-100) for 5 min. After that, the seeds were washed with sterile distilled water five times. The surfaced-sterilized seeds were sown on 1/2 MS agar plates containing kanamycin (50 mg/ml) and vernalized in the dark at 4℃ for 3 days. After vernalized seeds were transferred to a growth chamber and exposed to continuous white light (100 mmol m-2 s-1) for 6 h at 23℃ for germination. The plate which sown seeds then kept the dark condition for 48 h at 23℃. Finally, the seed in the plate was incubated for 24 h at 23℃ to select T1 plants that had expanded green cotyledons.
Identification of the gata25 mutant and validation of CRISPR/Cas9-mediated target mutation
For the identification of gata25 mutant lines, genomic DNA from young leaves was extracted for use in the polymerase chain reaction (PCR)-amplified reaction according to the preparation of plant genomic DNA [37]. Briefly, the young leaves were ground with a pestle and was added 400 ml of modified Edwards solution (200 mM Tris-HCl, 25 mM EDTA, 1% (w/v) SDS, 400 mM LiCl, pH 9.0), and the sample vortexed. After the mixture sample was centrifuged at 13,000 ´ g for 5 min, the supernatant was mixed with an equal volume of isopropanol. The sample was centrifuged at 13,000 ´ g for 10 min and then the supernatant was discarded. The pellet was washed with 1 ml of 70% ethanol. Following centrifugation at 13,000 ´ g for 5 min, the precipitation was dried and dissolved in 20 ml of DNase-free distilled water. The extracted genomic DNA of each transgenic plant and wild type was performed PCR to amplify the surrounding target site using specific primers (Supplementary Table S1). The PCR products were confirmed by the T7 endonuclease I (T7E1) assay [38]. To perform of T7E1 assay, Each PCR product was denatured at 95℃ for 5 min. Then, annealed at -2℃ per second temperature ramp to 85℃ for 5 sec and -0.1℃ per second temperature ramp to 25℃ for 10 min. The generated hetero-type DNA was digested with T7E1 enzyme (NEB, Ipswich, MA, USA) at 37℃ for 30 min, then electrophoresed on 2% (w/v) agarose gel.
For validation of mutations, the PCR was performed to amplify the neighboring on-target region using genomic DNA of selected homozygous plant, and then the PCR product was analyzed by the Sanger sequencing.
Evaluation of hypocotyl length
To measure hypocotyls, 5 days after sowing, seedlings that were not in contact with others were photographed with a Leica EZ4E microscope. The standard for measuring the hypocotyl length was the distance from the collet of root hairs to the ‘v’ made by the cotyledon shoulder using iSolution Lite software.
Quantitative real-time PCR (qRT-PCR)
Total RNAs were isolated by using TRIzol reagent (Invitrogen). The isolated total RNAs were treated as RNase-free DNaseI (Qiagen). The first-strand cDNA was synthesized from 1000 ng of total RNA using SuperScript III Reverse Transcriptase (Invitrogen). PowerUpTM SYBRTM Green Master Mix (Thermo Fisher) was used to calculate double-strand DNA synthesis for the real-time PCR reaction. To compare gene transcription levels, the level of PP2A mRNA expression (At1g13320) was used as the control. Details of the primers used in this study are provided in Supplementary Table S1.
Transcriptional activation analysis (TAA)
Transcriptional activation analysis was performed using protoplast isolated from leaves of Arabidopsis thaliana. As previously described, protoplast isolation and polyethylene glycol (PEG)-mediated transformation of reporter and effector constructs were performed [39]. For transcription activation activity, the protoplasts were transfected with constructs incubated for 12 h, the GUS protein produced was extracted. The GUS protein activity was measured by using the SPECTRAmax GEMINI XS microplate spectrofluorometer (Molecular devices) for 4-methylumbelliferone, a degradation product of the reaction.
Statistical analysis
The data are presented as mean of at least three independent biological replications ± standard deviation (SD). Differences were considered statistically significant when the P < 0.05 (labeled ‘*’), P < 0.01 (labeled ‘**’) or P < 0.001 (labeled ‘***’) using a pairwise Student’s t-test.