Materials
Cell culture media, penicillin-streptomycin, and trypsin EDTA were purchased from Biosera (Ringmer, UK). Bovine Fetal Serum (FBS) was purchased from Gibco, Thermo Fisher Scientific (Germany). The MTT powder_2-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide_ was purchased from MELFORD (United Kingdom). Vincristine (VCR) and Propidium iodide solution were purchased from Sigma Aldrich (Germany). Also, Caspase-3: 9662S, NF-κBp56: 3033T, and GAPDH: 2118S antibodies applied in western blot analysis were purchased from Cell Signaling Technology company (USA). ROS assay Kit was purchased from Teb Pazhouhan Razi Company. Annexin V apoptosis detection kit was purchased from the BD Biosciences company. RealQ plus 2x master mix green high ROX and RevertAid Reverse transcriptase (RT) were purchased from ampliqon (Denmark) and Thermo Fisher Scientific (USA), respectively. TRIzol Reagent was purchased from Zaver Zist Azma(Iran).
Preparation of the B. persicum seeds extract
To prepare B. persicum seeds’ methanolic extract, the plant seeds were collected from the Jabalbarez foothills of a private land (the owner land: Mr. Mahdi Hatami) of Jiroft city in Kerman province of Iran and authenticated by Dr. Seyed Mansour Mirtadzadini (Specimen number: 3843), the botanist at the herbarium of biology department of Shahid Bahonar University of Kerman, Kerman, Iran (https://biol.uk.ac.ir/). The specimens were collected with the permission of the landowner. The seeds were then dried in the shade at room temperature (22-25 °C), followed by grinding with an electric milled. Next, the obtained powder was mixed with methanol (80%) and shaken at room temperature for 48 hours. The obtained extract was refined several times with Whatman filter paper (Grade1) to get a clear solution, which was then concentrated via a rotary evaporator at 40 °C to remove the organic solvent.
GC-MS analysis
The GC-MS process and data analysis were performed according to the protocol of Sharififar et al. [28]. In brief, the carrier used was helium with a flow rate of 1 mL/min (split ratio 1:200) with an injection volume of 0.2 μL. The detector temperature was 290 °C and the injector temperature was 220 °C. After keeping the oven temperature at 50 °C for 3 minutes, it gradually increased to 160 °C (with the rate of 3 °C/min) and, after ten minutes, it gradually increased to 240 °C with a 3 °C rise. GC-MS analyzes were performed using Shimadzu QP 5050 operating at 70 eV ionization energy, equipped with an HP-5 capillary column with helium as the carrier gas. The compounds were determined by comparing their relative retention time (RT) and mass spectra with those of standards, Wiley library data of the GC–MS system, and literary data. To calculate relative retention indices (RRI), alkanes were utilized.
Cell culture
To evaluate the cytotoxic effect of the extract, MCF-7, MDA-MB-231, and MCF-10A cell lines were purchased from the Iranian Genetic Resources Center, Tehran, Iran. DMEM and RPMI media containing 10% FBS and 1% antibiotic were used to proliferate MCF-7 and MDA-MB-231 cells, respectively. Also, the medium containing 5% FBS, 5% horse serum, and 1% antibiotic was used for the proliferation of MCF-10A cells. The cells were incubated at 37 °C, in 5% CO2, with 95% humidity.
MTT assay
The viability of cells treated with the extract and drug was assessed by the MTT assay. Toward this end, at first, 5000 cells/well of each MCF-7, MDA-MB-231, and MCF-10A cell line were cultured in a 96-well plate and incubated for 24h. After this time, the cells were treated with doses ranging from 20 to 200 μg/ml of the BPSE. In addition to the extract, MCF-7 cells were exposed to a range of 50 to 500 nM of VCR, and their viability was determined. To evaluate the effect of the BPSE in combination with VCR, MCF-7 cells were treated with 100, 200, and 400 nM of VCR combined with 60, 80, 100, and 120 μg/ml of BPSE, respectively. After 24 h of treatment, 30 μl of the MTT solution (0.5 μg/ml in PBS) was added to each well, and plates were incubated for 3h. After this time, the culture medium was removed and 100 μl of DMSO was added to each well, followed by slightly shaking the plate for 40 min. Finally, the absorption values of each well were evaluated at 570 nm by an ELISA reader (Eliza MAT 2000, DRG Instruments, GmbH, Marburg, Germany), and the percentage of cell viability was calculated.
Noteworthy, after determining the effect of different concentrations of these compounds on the cells, their IC30 (100 μg/ml of the extract and 200 nM of VCR) were used in further tests. These features were also combined to evaluate their combination effect.
Intracellular ROS assay
The reactive oxygen species (ROS) level in the MCF-7 cells was measured with the ROS assay Kit according to the company instructions. Briefly, the cells were cultured in a 96-well plate, and once they reached 80% confluency, treated with intended concentrations of the extract (80-200 μg/ml), VCR (200 μg/ml), and their combination (100 μg/ml of the extract combined with 200 μg/ml of VCR). After treatment, the cell culture medium was removed and 100 μl of ready assay buffer was added to each well. After removing the buffer, 100 μl of DCF staining buffer was added and the plate was held at 37 °C in the dark for 60 minutes. After that, 100 μl of stimulator buffer was added and the plate was kept at 37 °C for 20 min in the dark. Finally, the wells were drained, 100 μl of the ready assay buffer was added, and the plate was read by a plate reader at the excitation wavelength of 485 nm and the emission wavelength of 538 nm.
Gene expression assessment
The real-time PCR technique was performed to assess the effect of the compounds on the expression of MYC, BAX, BCL-2, and P53 genes. Briefly, RNA was first extracted from treated cells using TRIzol reagent according to the manufacturer's protocol. A NanoDrop™ 2000/2000c spectrophotometer was used to measure the quality and concentration of the extracted RNA. Next, cDNA was synthesized by Thermo Scientific Kit. After cDNA synthesizing, real-time PCR was done by using the RealQ Plus 2x Master Mix (AMPLIQON). The GAPDH gene was used as a housekeeping gene. The primers designed for each gene were controlled for their specificity using BLAST on the NCBI site. The formula 2-ΔΔCT was used to estimate the percentage of the relative gene expression. The primers used in this study were as follow; GAPDH forward primer: ‘5CCCCAGCAAGAGCACAAGAGG3' and reverse primer: ‘5AGGAGGGGAGATTCA-GTGTGG 3’; MYC forward primer: 5'CCCAAACCAGAAATGATGTTG3' and reverse primer: 5'GAC-CTACTTTGAGACTGAGAC3'; BCL-2 forward primer: 5'TGGGGTCATGTGTGTGGAG3' and reverse primer: 5'CGGTTCAGGTACTCAGTCATCC3'; BAX forward primer: 5'CCCGAGAGGTCTTTTTCC-GAG3' and reverse primer: 5'CCAGCCCATGATGGTTCTGAT3'; P53 forward primer: 5'ACCTAAAA-GGAAATCTCACCC3' and reverse primer: 5'ACCCTGAGCATAAAACAAGTC3'.
Western blot analisis
For western blotting, firstly, MCF-7 cells were seeded on a six-well plate and allowed to attach for 24h. The cells were then treated with the intended concentrations of VCR, BPSE, and their combination, and incubated for 24h. Next, the cells were harvested and homogenized by a buffer containing 1 mM EDTA, 0.1% SDS, 1% NP-40 with protease inhibitors (1 mM phenylmethyl fluoride) Sulfonyl (2.5 mg/ml leupeptin, 10 mg/ml aprotinin) and 1 mM sodium orthovanadate, 0.1% Na deoxycholate and 10 mM Tris-HCl (pH 7.4). Next, the samples were centrifuged at 4 °C for 14 minutes at 14000 rpm, and the supernatant was retained. Then, the extracted proteins’ concentration was measured using the Bradford method (Bio-Rad Laboratories, Feldkirchen, Germany). At the next step, an equal amount of protein was loaded on an SDS-PAGE gel (9%). After loading, the fractionated proteins were transferred to a nitrocellulose membrane by electrophoresis (Hybond ECL, GE Healthcare Bio-Sciences Corp., Piscataway, NJ, USA). Next, the blocking with skim milk (5%) in TBS-T (Tris-buffered saline with Tween 20) was done for 24h at 4 °C. The membrane was then incubated overnight with rabbit monoclonal antibody Caspase-3 and NF-κB p65, at 4 °C. After washing with TBS-T (three times, 5 minutes), the blots were exposed to the secondary antibody of horseradish peroxidase mixture (GE Healthcare Bio-Sciences Corp) for 60 min at room temperature. Antibody-antigen complexes were evaluated using the ECL system and exposed to the Lumi-Film chemical detection film (Roche Applied Science, Mannheim, Germany). Image j analysis software was used to analyze the intensity of expression. Noteworthy, Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the loading control.
Flow cytometry analysis
The incidence of apoptosis and necrosis in the cells exposed to the extract, VCR, and their combination was examined using the Annexin-V PE/7-ADD apoptosis diagnosis kit based on the manufacture gaudiness. Toward this end, after treating the cells with the compounds for 24h, the cells were washed with PBS and suspended in 100 μl of Annexin V binding buffer, 5 μl of PE Annexin V, and 5 μl of 7-AAD, followed by keeping in the dark for 15 minutes. Finally, after adding 400 μl of binding buffer, the samples were assayed using a flow cytometer (Becton Dickinson, Franklin Lakes NJ).
Cell cycle assay
To assess the effect of the compounds on the cell cycle, the cells were treated with the compounds for 24h. Next, they were detached from the plate bottom by trypsin and washed twice with PBS. Cells were then fixed with 70% ice-cold ethanol for 30 minutes, treated with 20 μg/ml of propidium iodide and 10 μg/ml of RNase, and incubated in the dark at 37 °C for one hour. Finally, the samples were evaluated by BD FACSCalibur flow cytometer at a wavelength of 488 nm, and analyzed by Cell Quest 3.3 software.
Statistical analysis
Data were analyzed using SPSS software. Analysis of variance (ANOVA) and the Tukey test were used to evaluate the significant differences among groups. All experiments were performed with at least three independent repetitions. The results were shown as mean ± SEM, and p <0.05, p <0.01, and p <0.001 were considered statistically significant values.