Autism Spectrum Disorder (ASD), like many neurodevelopmental disorders, has complex and varied etiologies. Advances in genome sequencing have identified multiple candidate genes associated with ASD, including dozens of missense and nonsense mutations in the NMDAR subunit GluN2B, encoded by GRIN2B. NMDARs are glutamate-gated ion channels with key synaptic functions in excitatory neurotransmission. How alterations in these proteins impact neurodevelopment is poorly understood, in part because knockouts of GluN2B in rodents are lethal. Here, we demonstrate that zebrafish GluN2B displays similar structural and functional properties to human GluN2B. Using CRISPR-Cas9, we generated fish lacking all functional GluN2B (grin2B-/-) and surprisingly found that they survive into adulthood. Given the prevalence of social deficits in ASD, we assayed social preference in the grin2B-/- fish. Wild-type fish develop a strong social preference by 3 weeks post fertilization (wpf). In contrast, grin2B-/- fish at this age exhibit significantly reduced social preference. This phenotype is specific for GluN2B and not due to general NMDAR dysfunction, as frameshift mutations in other NMDAR subunits do not generate social deficits. Notably, the lack of GluN2B does not result in a broad disruption of neurodevelopment, as grin2B-/- larvae do not show alterations in spontaneous or photic-evoked movements, are capable of prey capture, and exhibit learning capabilities. Whole-brain imaging of grin2B-/- larvae revealed a reduction in inhibitory neurons in the subpallium, a region linked to ASD in humans, but showed that overall brain size and E/I balance in grin2B-/- is comparable to wild-type. Together, these findings highlight the specific role of GluN2B in ASD etiologies and establishing a disease-relevant in vivo model for future studies.
Research Article
Disruption of grin2B, an ASD-associated gene, produces social deficits in zebrafish.
https://doi.org/10.21203/rs.3.rs-1766152/v1
This work is licensed under a CC BY 4.0 License
You are reading this latest preprint version
NMDA receptors
GluN2B
Autism Spectrum Disorders
social behaviors
NMDARs are best known for their roles in neurotransmission but also play critical roles in early brain development. Their dysfunction has been implicated in a myriad of neurodevelopmental diseases, including ASD. How NMDAR dysfunction contributes to these disease etiologies, however, is poorly understood. We demonstrate that zebrafish lacking the GluN2B subunit of the NMDAR, unlike available rodent models, are viable into adulthood. Notably, they exhibit a highly specific deficit in social behavior. As such, this zebrafish model affords a unique opportunity to study the roles of GluN2B in development and disease etiology.
Autism Spectrum Disorder (ASD) is a neurodevelopmental disorder affecting upwards of 1 in 100 children (Lai, Lombardo, & Baron-Cohen, 2014; Roman-Urrestarazu et al., 2021; Zeidan et al., 2022). ASD is characterized by impairments in social skills, sensory processing, and communication as well as stereotypic behaviors (American Psychiatric Association, 2013). Symptoms typically present in early childhood and effective therapies are lacking (Baio et al., 2018; Fombonne, 2009). Causal mechanisms underlying changes in early brain development leading to ASD are not well-defined. The genetic causes of ASD are exceptionally diverse, and hundreds of candidate loci have been identified (De Rubeis & Buxbaum, 2015; Iossifov et al., 2012; O'Roak, Vives, Fu, et al., 2012; Satterstrom et al., 2020; Stessman et al., 2017). Many ASD-associated genes are expressed in both developing excitatory and inhibitory neurons and play known roles in synaptic transmission (Satterstrom et al., 2020). Given the complex etiology of ASD, a deeper understanding of the role of these ASD-associated genes in early development is needed.
NMDA receptors (NMDARs) are glutamate-gated, calcium-permeable ion channels that mediate a slow component of excitatory transmission (Hansen et al., 2021). They play key roles in early brain development (Chakraborty, Murphy, & Coleman, 2017) and the plasticity underlying higher order processes (Hunt & Castillo, 2012; Paoletti, Bellone, & Zhou, 2013). NMDARs are obligate heterotetramers, comprised of two GluN1 subunits and typically some combination of GluN2(A-D) subunits (Hansen et al., 2021). The various GluN2 subunits impart distinct functional and cell biological properties to the receptor and play myriad roles in brain development. Accordingly, mutations in NMDAR subunits are associated with numerous neurodevelopmental disorders including ASD, epilepsy, intellectual disability, and schizophrenia (Geisheker et al., 2017; Hardingham & Do, 2016; Yuan, Low, Moody, Jenkins, & Traynelis, 2015).
GRIN2B, which encodes the GluN2B subunit, is a high-confidence ASD gene (O'Roak, Vives, Fu, et al., 2012; O'Roak, Vives, Girirajan, et al., 2012; Satterstrom et al., 2020). GluN2B is highly expressed in humans during early brain development and has critical functions in neurogenesis and circuit formation (Bagasrawala, Memi, N, & Zecevic, 2017; Bell et al., 2018; Nacher & McEwen, 2006). The complex activities of GluN2B in early development remain incompletely defined, in part because murine knockouts of GluN2B do not survive past perinatal stages (Kutsuwada et al., 1996). As a highlight of this complexity, mutations causing both loss and gain of GluN2B function are associated with ASD as well as other neurodevelopmental disorders (Fedele et al., 2018; Rea & Van Raay, 2020).
Here, we investigate the validity and robustness of the zebrafish model to study GluN2B in development. This system affords detailed analysis of the role of GluN2B in early brain development and the emergence of complex behaviors, offering numerous readouts of the developing nervous system. Additionally, zebrafish are highly social creatures (Fontana et al., 2022), facilitating the study of the role of GluN2B in social preference development. In zebrafish, the GluN2B subunit is encoded by two paralogous genes: grin2Ba and grin2Bb (Cox, Kucenas, & Voigt, 2005). We find that fish with frameshift mutations in both grin2B paralogues, and thus lacking all GluN2B, survive into adulthood and are fertile. This offers a unique opportunity to study the developmental roles of GluN2B and characterize its requirements in brain development and the formation of various zebrafish behaviors. We find that zebrafish lacking GluN2B show social deficits, despite having no significant changes in whole-brain size, glutamatergic neuron density, or overall excitatory/inhibitory (E/I) balance. Nevertheless, we find significant reduction in a marker of inhibitory neurons in a small subset of regions, most notably the subpallium, an area containing subcortical structures whose dysfunction are associated with ASD phenotypes (Fuccillo, 2016; Janouschek et al., 2021).
Zebrafish Maintenance
Adult zebrafish strains were fed a diet of artemia and GEMMA micropellets and maintained at 28.5°C under a 13:11 hour light to dark cycle. The wild-type strain used for all experiments was a hybrid wild-type background consisting of Tubingen long-fin crossed to Brian’s wild type. The experiments and procedures were approved by the Stony Brook University Institutional Animal Care and Use Committee.
Whole-cell electrophysiology
Human embryonic kidney 293 (HEK293) cells were maintained and grown as previously described (Alsaloum, Kazi, Gan, Amin, & Wollmuth, 2016; Yelshansky, Sobolevsky, Jatzke, & Wollmuth, 2004). Zebrafish cDNA constructs were commercially synthesized (GenScript) in a pcDNA3.1(1)-p2A-eGFP vector. Human GluN1 (hGluN1) and either human GluN2B (hGluN2B) or zebrafish GluN2Bb (zGluN2Bb) cDNA constructs, were cotransfected into HEK293 cells along with a separate peGFP-Cl construct at a ratio of 4:4:1 (N1:N2:eGFP) for whole-cell recordings. After transfection, cells were bathed in medium containing the GluN2 competitive antagonist DL-2-amino-5-phosphopentanoic acid (100 mM, Tocris Bioscience) and Mg2+ (100 mM). All experiments were performed 24-48 h after transfection. Whole-cell currents were recorded at room temperature (20°C-23°C) as previously described (Alsaloum et al., 2016; Amin et al., 2017; Yelshansky et al., 2004). Patch microelectrodes were filled with an intracellular solution (in mM as follows): 140 KCl, 10 HEPES, 1 BAPTA, 4 Mg21-ATP, 0.3 Na1-GTP, pH 7.3 (KOH), 297 mOsm (sucrose). Our standard extracellular solution consisted of the following (mM): 150 NaCl, 2.5 KCl, and 10 HEPES, pH 7.2 (NaOH). Currents were measured within 10 min of going whole cell. External solutions were applied using a piezo-driven double-barrel application system. For display, NMDAR currents were digitally refiltered at 500 Hz and resampled at 1 kHz.
CRISPR-Cas9 Gene Targeting and Genotyping
gRNAs were designed through the IDT custom gRNA Design Tool. gRNAs were complexed to Cas9 protein, to form a ribonucleoprotein, using the Alt-R CRISPR-Cas9 System (IDT); 0.5 nl of ribonucleoprotein (25 pg of gRNA and 125 pg of Cas9 protein) was injected into the cell of pronased, 1-cell wild-type embryos. 20-25 injected embryos for each gRNA were assayed by PCR for lesions using primers flanking the gRNA target site. Those siblings, in which lesions were detected in the F0, were grown into adulthood to be assayed for germline transmission. To minimize the effects of potential off-target endonuclease activity, all lines were outcrossed at least twice prior to assaying behavior in any paradigm. Individual mutations were isolated and sequenced using Sanger Sequencing.
Primers used for both initial screen and subsequent genotyping:
grin1a – F (TGGGCTGGCTTCGCTATGAT) and R (GGGTCGTTGATGCCGGTGAT)
grin1b – F (GGTGCCCCTCGGAGCTTTTC) and R (GGAAGGCTGCCAAATTGGCAGT)
grin2Aa – F (AGACCCCCACGGACCGTCTTTC) and R (CGTGCCTTTGGGGTTTTGCACA)
grin2Ab - F (GCTCACTCCTCCGCACTAACTT) and R (GACCCCACAGCAGCCAGACA)
grin2Ba – F (TGGTCTCCGTCTGGGCCTTC) and R (GACACCTGGTCCACGTACTCCT)
grin2Bb – F (CTATTTGGCTTCTTTGGGGTTTGGT) and R (CGAAGAAGGCCCAGACCGAAA)
grin2Da – F (AAGACGTGTCTGTGTTTTCTTCTG) and R (CGGAGTTATTAAACACCAGAGC)
grin2Db – F (TTCTGTGGGCTCTGGTCTTT) and R (TAGCTGGCCAGGAAGATGAC)
fmr1 – F (GAATATGCAGCCTGTGATGCCACCCTAAATGAAATCGTCACATTAGAGAGGGTA) and R (TTGGCCAAACTCCATGACATCCTG) followed by a digest with RSAI
rt-PCR
RNA was extracted from pools of either 4 larvae at 3 dpf or 2 larvae at 5 dpf, in 200 uL of Trizol (Invitrogen) and isolated with Direct-zol RNA Minipreps (Zymo Research). cDNA was synthesized from 200ng of RNA using Superscript II Reverse Transcriptase (Invitrogen) and analyzed using the following primers:
grin2Ba – F (TGGTCTCCGTCTGGGCCTTC) and R (GAAGCGAAACGGAGGAGAG)
grin2Bb – F (CTGTCGGCTATAATCGCTGC) and R (CGAAGAAGGCCCAGACCGAAA)
Zebrafish behavior assays:
Zebrafish were grown in 150 mm Petri dishes at densities of less than 100 per plate. To minimize any effects of genetic background on the behavior, larvae were assayed from multiple clutches from different parents. Genotypes were acquired post-hoc for all assays, as outlined above, to ensure experimenters were blind to genotype.
1) Social Behavior assay
Larvae were grown in Petri dishes until 5 dpf and were transferred to juvenile cylinders with densities between 35 and 50 per cylinder until the assays were performed at 1, 2, 3 or 4 wpf. Juvenile zebrafish were placed in a lane of a social behavior chamber (Geng et al., 2021) containing system water prior to the assay. The social behavior chamber was placed into a Zantiks MWP unit (Zantiks) held at a temperature of 28°C and fish were allowed to acclimate for 5 minutes. Movement of test fish was recorded for 20 minutes, and social preference index was calculated through the following formula:
Where 
represents the time spent in zones 1-4. All assays were run with control fish from relative clutches (either homozygous intercrosses or heterozygous intercrosses).2) Spontaneous and photic evoked behavior
Spontaneous and photic-evoked assays were performed as previously reported (Zoodsma et al., 2020).
3) Prey-capture Feeding Assay
Prey-capture assays using paramecia were performed as previously reported (Zoodsma et al., 2020). Larval prey capture learning assays were adapted from (Geng et al., 2021). At 5 and 6 dpf, fish in the naïve group were fed fish flakes (Hikari USA inc.), while fish in the experienced group were fed Paramecia Caudatum (Carolina Biological Supply). Feedings occurred for 6 hours each day; food was refreshed and media washed after 3 hours. Prey-capture paramecia feeding experiments were run at 7 dpf, as previously reported (Zoodsma et al., 2020), aside for substituting Paramecia Multimicronucleatum for Paramecia Caudatum.
qPCR
cDNA was generated from RNA extracted from pools of either 4 larvae at 3 dpf or 2 larvae at 5 dpf as outlined above. qPCR assay was run using PerfeCTa SYBR GreenFastMix (QuantaBio) on a LightCycler480 (Roche Diagnostics). Transcript levels were obtained from averaged biological replicates for each sample and were normalized to ß-actin. Primers utilized in these experiments:
grin1a – F (ATAAAGACGCCCGCAGGAAGC) and R(CGTGCTGACAGACGGGTCCGAC);
grin1b – F (AATGCAGCTGGCCTTTGCAGC) and R(CTCTTGATGTTGGAGGCCAGGTTG)
grin2Aa – F (GCTTCTGCATTGACATCCTCA) and R(AACGCTCCTCATTGATTGTCAG)
grin2Ab - F (AGACATCCTGAAGAAGATCGC) and R(CTCTGACCGCTCTTCATTTATG)
grin2Ba – F (CATCAGTGTGATGGTGTCCAG) and R(CACAGGACTGAAGTACTCGAAG)
grin2Bb – F (GTCTGTCAAATTCACCTACGATC) and R(GCACTGAGAAGTCAATGACCT)
grin2Ca – F (GAGCGTTCAGAGATCATTGACT) and R(CACGACCGTAAGACACATGAC)
grin2Cb – F (TCCTAAAGAAGCTCTCACGCA) and R(TGAGCGCTCCTCGTTGATG)
grin2Da – F (CAGAGGTTGTGGAGTTCTCTG) and R(GCACTGAGAAGTCAATGACCT)
grin2Db – F (GTTTCTGCATCGACATCCTCA) and R(CGTCAGGCACATCACAAAC)
Whole-brain confocal scans
grin2B-/- fish were crossed to fish heterozygous for both grin2B mutations and containing two transgenic lines: Tg(dlx6a-1.4kbdlx5a/dlx6a:GFP), (Ghanem et al., 2003), and Tg(vglut:DsRed) (Kinkhabwala et al., 2011). Genotypes were acquired post-hoc distinguishing grin2B controls from grin2B-/- fish. 6 dpf larvae were placed in PTU at 1 dpf. Larvae positive for both transgenes were mounted in 1.5% low melting point agarose in a Lab-Tek II Chambered Coverglass. Brain images were acquired on an Olympus FV-1000 confocal microscope at a magnification of 30x, through a Z-range of 350 microns, at 2-micron increments. Laser intensity was adjusted throughout the scan to adjust for loss in deeper layers. Two image sets were acquired for each brain, one encompassing the anterior to middle regions and the other encompassing the middle to posterior extent. These image sets were stitched in ImageJ using the Pairwise Stitching plug-in (Preibisch, Saalfeld, & Tomancak, 2009). Stitched images were registered utilizing the Zebrafish Brain Browser and analysis of registered brains was done through the Cobra Z pipeline (Tabor et al., 2019). Full-brain visualization and coronal sections were generated using the Zebrafish Brain Browser (Marquart et al., 2015). Measurement of mean intensity in subdivisions of the subpallium used ROIs previously computationally defined from expression data (Gupta et al., 2018).
Experimental design and statistics:
Data analysis was performed using IgorPro, Excel, RStudio and MiniTab 18. Average values are presented as mean ± SEM except for boxplots which indicate the median, quartiles, and range. For experiments where a control was compared to an individual mutant group, unpaired two-tailed Student’s t-test was used to test for significance. For comparisons of multiple groups, a one-factor ANOVA, followed with a post hoc Tukey’s test was used. A two-factor ANOVA was used when looking at both genotype and time as variables. Estimation plots were generated using Python and DABEST (Ho, Tumkaya, Aryal, Choi, & Claridge-Chang, 2019). Statistical significance was set at p < 0.05.
Sex in zebrafish is indeterminate at the age of the larval and juvenile behavior assays in this study and was thus not a factor in experimental design.
Zebrafish GluN2B orthologues share high sequence and domain homology with human GluN2B
Each NMDAR subunit has two zebrafish paralogues that show high degrees of sequence similarity with their human counterparts (Cox et al., 2005). To assess the relevance of studying zebrafish GluN2B as a model of human disease, we analyzed the structural and functional similarities between the human GluN2B (hGluN2B, encoded by GRIN2B) and the zebrafish paralogues (zGluN2Ba and zGluN2Bb, encoded by grin2Ba and grin2Bb, respectively).
All glutamate receptors share a common topology consisting of an amino-terminal (ATD) and a ligand-binding (LBD) domain, both located extracellularly, a transmembrane domain (TMD) embedded in the membrane forming the ion channel, and an intracellular C-terminal domain (CTD) (Figure 1A). The required components for ion channel function are the LBD and the TMD. Zebrafish GluN2B paralogues share high protein sequence similarity to each other, with >95% similarity in the LBD and TMD (Figure 1B). Notably, the human orthologue, hGluN2B, shares greater than 90% amino acid similarity with each zebrafish paralogue in all domains except the early ATD and CTD (Figure 1B). Each component of the LBD and TMD also contain the same number of amino acids, highlighting the conservation of protein domains both between species and between paralogues (Figure S1). Hence, zebrafish paralogues presumably have the same basic structure as their mammalian counterparts.
Zebrafish GluN2B can form ion-conducting channels with human GluN1
Functional NMDARs require co-expression of GluN1 and GluN2 subunits. To compare the physiological properties of zebrafish and human GluN2B, we co-transfected either human GluN2B (hGluN2B) or zebrafish GluN2Bb (zGluN2Bb) along with human GluN1 (hGluN1) into a heterologous expression system, HEK293 cells. Zebrafish GluN1 paralogues (zGluN1a and zGluN1b) form Ca+2 -permeable channels with mammalian GluN2 subunits (Zoodsma et al., 2020). Similarly, we found that glutamate applications to HEK293 cells transfected with hGluN1 and zGluN2Bb, evoked inward currents (Figure 1C) whose magnitude, on average was indistinguishable from that observed in hGluN1/hGluN2B receptors (Figure 1D). A zGluN2Ba construct also produced membrane currents when co-expressed with hGluN1 (data not shown), but current amplitudes were too small to work with reliably. Because of the high sequence similarity between paralogues, we believe this poor expression is a property of the construct itself and not a property of zGluN2Ba (Figures 1B & S1).
A key functional feature of GluN2B-containing NMDARs, as compared to GluN2A-containing receptors, is a slow deactivation rate in response to brief synaptic-like glutamate applications (Amin, Leng, Gochman, Zhou, & Wollmuth, 2018; Paoletti et al., 2013). To test whether NMDAR containing zGluN2Bb showed slow deactivation kinetics, we applied brief (2 ms) glutamate applications to hGluN1/hGluN2B or hGluN1/zGluN2Bb receptors (Figure 1E). We detected no significant difference in deactivation rates between hGluN2B and zGluN2Bb-containing NMDARs (Figure 1F). Hence, zGluN2Bb replicates a key functional feature of human GluN2B-containng NMDARs. Together, the sequence and functional similarities between zebrafish and human GluN2B suggest zebrafish are an appropriate model to study the developmental functions of GluN2B.
Generation of zebrafish grin2Ba and grin2Bb loss of function mutations
To study GluN2B in zebrafish development, we disrupted the grin2Ba and grin2Bb genes using CRISPR-Cas9 (Chang et al., 2013; Hwang et al., 2013). gRNA target sites were designed to disrupt the highly conserved SYTANLAAF motif, found in the M3 transmembrane helix (Figure 2A) (Hansen et al., 2021; Wollmuth & Sobolevsky, 2004). We generated 3 germline mutations in each gene (Figure 2B). Frameshifts and early stop codons were generated in all but one allele (Figure 2C), and the alleles generating the earliest stop codons, sbu310 (grin2Ba) and sbu311 (grin2Bb), were selected for further study. Both alleles yielded only mRNA transcripts harboring the deletions (Figure 2D). Given that the stop codon occurred prior to the end of the SYTANLAAF motif, these mutant transcripts would yield proteins lacking an intact pore, a functioning ligand binding domain (due to the lack of S2), and no M4 transmembrane segment, which would make any generated protein non-functional (Figure 1B).
Zebrafish lacking GluN2B are viable
Zebrafish homozygous mutant for either grin2Ba or grin2Bb are viable and survive in Mendelian ratios into adulthood (data not shown). To test the developmental requirement for GluN2B, we generated grin2B double mutants (herein notated as grin2B-/-) fish that are homozygous mutant for both the grin2Ba and grin2Bb alleles, thus lacking all GluN2B. grin2B-/- larvae are viable, are recovered in Mendelian ratios and show no gross morphological defects at 6 dpf (Figure 2E). Surprisingly, the grin2B-/- larvae also survive into adulthood and are fertile. This contrasts with mice lacking GluN2B, which display a suckling defect and die shortly after birth (Kutsuwada et al., 1996). The extended survival of zebrafish lacking GluN2B enables study of the roles of this subunit throughout development.
Zebrafish lacking GluN2B have impaired social behavior
Mutations in GRIN2B are associated with ASD in humans (Hu, Chen, Myers, Yuan, & Traynelis, 2016). Because social deficits are a defining feature of ASD, we asked whether grin2B-/- fish also display anomalous social behaviors. To assay social preference in zebrafish, we recorded activity of a freely swimming fish in a rectangular lane, where the short ends were separated by glass and contained either an age-matched wild-type conspecific or was empty (Figure 3A). The apparatus consisted of 10 such lanes to allow assays of 10 fish simultaneously (Geng et al., 2021). We divided each lane into 4 equal zones, with Zone 4 located adjacent to the conspecific.
Zebrafish develop a strong social preference to interact with conspecifics by 3 wpf (weeks post fertilization) (Dreosti, Lopes, Kampff, & Wilson, 2015). Consistent with this finding, wild-type fish at 1 wpf spent approximately equal amounts of time in each zone, indicating no social preference, whereas fish at 3 or 4 wpf spent over half of their time in Zone 4, indicating a strong social preference (Figure 3B). To quantify social preference of individual test fish, we used a social preference index (SPI) (Adapted from (Geng et al., 2021), see Materials and Methods). SPI values closer to +1 indicate a strong social preference, those closer to -1 indicate a social aversion, and those around 0 indicate no social preference. Consistent with the observations of zone preference (Figure 3B), wild-type fish exhibit increased SPI at 3 and 4 wpf as compared to 1 and 2 wpf (Figure 3C left panel). In contrast, grin2B-/- fish do not show social preference over this same developmental period (Figure 3C, right panel), although marginal non-significant increases were observed each week. When compared to age-matched wild-type controls, grin2B-/- fish show significantly less social preference at both 3 and 4 wpf (Figure 3D & Supplemental Table 1). This social preference deficit is not driven by the lack of a single grin2B paralogue, since the single grin2Ba and grin2Bb mutants show wild-type social behavior (Supplemental Figure 2 & Supplemental Table 2).
Social preference in juvenile zebrafish results in a behavior coupling of social partners (visually-driven coordinated swim bouts) in age-matched conspecifics (Dreosti et al., 2015). Rodents show increased social preference to littermates (Clemens & Brecht, 2021). Given this, two potential confounding factors for the grin2B-/- social deficit in our assay are the combined inability for grin2B-/- and wild-type fish to generate behavior coupling, and the possibility that wild-type zebrafish have increased social preference with fish from their same clutch. To test these possibilities, we used a modified social behavior paradigm in which all test fish were wild-type, and the age-matched conspecifics were either grin2B-/- or clutch-matched wild-type fish (Supplemental Figure 3A). Wild-type test fish showed strong social preference to both wild-type and grin2B-/- fish at 3 and 4 wpf and there was no difference in the magnitude of social preference (Supplemental Figure 3B & Supplemental Table 3). Hence, neither an inability to generate coupling, nor a clutch-preference, are the driving factors in the grin2B-/- social deficit.
FMR1 dysfunction in humans is associated with Fragile X Syndrome, a neurodevelopmental disorder that exhibits social deficits (Brodkin, 2008). We therefore tested zebrafish mutants lacking fmr1 to further validate the capacity of our social behavior paradigm to detect social preference deficits. Like grin2B-/- fish, zebrafish lacking fmr1 showed a social deficit as compared to wild-type controls at 3 wpf characterized by a reduced SPI (Figure 4A and Supplementary Table 4) and a reduced time spent in Zone 4 (Figure 4B). Notably, these same deficits were observed in fmr1 heterozygotes, indicating that the lack of only one fmr1 allele is sufficient for the social preference deficit (Figure 4A-B).
Lack of GluN2A or mutations in additional NMDAR subunit paralogues do not produce social deficits
Non-specific pharmacological inhibition of all NMDARs blocks social preference (Dreosti et al., 2015), suggesting the grin2B-/- social preference deficit might reflect a general phenomenon of reduced NMDAR activity and/or may be associated with any GluN2 subunit. To test these alternatives, we assayed social preference in fish lacking various NMDAR subunits (Figure 4C & Supplementary Table 4). Initially, we tested fish lacking grin1a or grin1b, genes encoding the obligatory GluN1 subunit, but did not observe social deficits (Figure 4C). To test the specificity of GluN2B-containing NMDARs in the development of social preference, we generated zebrafish knockouts in other NMDAR subunits (Supplemental Figure 4). Zebrafish mutant for both grin2Aa and grin2Ab, and thus lacking all GluN2A, also did not show a social deficit (Figure 4C). Additionally, no social deficit was observed in zebrafish lacking either grin2Da or grin2Db, genes encoding the GluN2D subunit. Together, these findings suggest that the lack of GluN2B specifically, and not other perturbations to NMDAR signaling, including a complete loss of GluN2A, is critical for the development of social behavior.
Zebrafish lacking GluN2B exhibit numerous wild-type behaviors
The social deficit in grin2B-/- fish could reflect a broad disruption of neurodevelopment and a lack of other basic behaviors and functions. To test this idea, we characterized additional behaviors.
To assay the developing nervous system, we used a spontaneous and photic-evoked locomotion paradigm in which spontaneous movement is monitored in larvae at 6 dpf in 24-well plates for 35 minutes, followed by removal of illumination, which elicits a visual motor response, a stereotypical zebrafish behavior (Burgess & Granato, 2007; Emran, Rihel, & Dowling, 2008). Notably, there was no difference between wild type and grin2B-/- fish in spontaneous movement in any period in the light, nor after the removal of illumination at 6 dpf (Figures 5A & 5B) as well as at earlier developmental timepoints (4 and 5 dpf) (Supplemental Figure 5). In alignment with these findings, grin2B-/- fish showed no differences in total distance traveled during the social behavior paradigm at 3 or 4 weeks (Supplemental Figure 6). Instantaneous response to a photic stimulus was measured by recording the distance traveled in the second after the removal of illumination. At 4, 5 and 6 dpf, grin2B-/- larvae exhibited wild type responses to this stimulus (Figure 5C). Together, these findings indicate that grin2B-/- larvae don’t display broad behavioral deficits and can respond to external stimuli.
Some ASD patients also present with intellectual disabilities (ID) (Al-Beltagi, 2021; Baio et al., 2018). To test whether grin2B-/- larvae exhibit deficits in learning, we assayed them on a learned feeding assay. Prey capture is a complex behavior, necessitating visual and motor integration (Semmelhack et al., 2014), and given experience, zebrafish show increases in both the number of attempted captures and successful captures of paramecia (Oldfield et al., 2020). grin2B-/- larvae are capable of capturing paramecia, but at a slightly diminished rate as compared to wild-type controls (Figure 5D), a phenotype not seen in the grin2Ba or grin2Bb single mutants (Supplemental Figure 7). To test whether the grin2B-/- larvae were capable of learning, we assayed zebrafish that were either from a naïve feeding group (fed flake food at 5 and 6 dpf and assayed with paramecia at 7 dpf), or from an experienced feeding group (fed paramecia at 5 and 6 dpf and assayed with paramecia at 7 dpf) (Oldfield et al., 2020) (Figure 5E). With experience, both wild-type and grin2B-/- larvae significantly increase their successful paramecia captures and do so to a comparable extent (Figure 5F). Hence, grin2B-/- fish are capable of learning, at minimum within the scope of this paradigm, comparable to wild-type.
Compensatory changes in NMDAR subunit expression in grin2B-/-
Nonsense-mediated decay (NMD) of mutant RNA can result in the transcriptional upregulation of similar genes (El-Brolosy et al., 2019). To test whether NMD results from grin2B mutations, we assayed the levels of mutated grin2Ba and grin2Bb mRNA in their respective zebrafish mutants at 3 and 5 dpf (Figure 6A). At 3 dpf, only a trending decrease in grin2Bb was observed, whereas at 5 dpf, a significant decrease in mutant mRNA were reported in both paralogues. Together, this suggests progressive NMD in the grin2B-/- larvae.
NMDAR subunits share similar structural domains and may thus be targets of transcriptional adaptation as the result of NMD. To test the possible upregulation of corresponding NMDAR subunits, we assayed the levels of the genes encoding GluN1, GluN2A, GluN2C and GluN2D. Upregulation was observed in grin1a, grin1b, grin2Ab and grin2Db at 3 dpf (Figure 6B). No change in transcript levels were reported in either grin2C paralogue. If NMD is the driving factor of these transcriptional changes, we would predict similar but potentially increased changes at 5 dpf, where the level of NMD in the grin2B mRNA transcripts was higher. Indeed, all the transcriptional upregulations reported at 3 dpf, as well as increases in grin2Da and a trending increase in grin2Aa, were observed at 5 dpf, often to a greater magnitude (Figure 6C). Together, these findings indicate a transcriptional upregulation of specific NMDAR subunits, potentially driven by NMD and transcriptional adaptation.
Whole-brain imaging of grin2B-/- fish reveals reduced inhibitory neuron populations in the subpallium but no gross anatomical changes
Various changes in brain architecture and neuron populations have been described in ASD patients, including alterations to E/I balances often due to reductions in inhibitory neuron populations (Contractor, Ethell, & Portera-Cailliau, 2021; Courchesne et al., 2019; Uzunova, Pallanti, & Hollander, 2016). To test if grin2B-/- fish had any such changes, we performed whole brain confocal scans of 6 dpf larvae. grin2B-/- larvae and controls containing transgenic lines labeling excitatory (vglut:DsRed) and inhibitory (dlx6a-1.4kbdlx5a/dlx6a:GFP), populations were mapped onto a reference using the Zebrafish Brain Browser (Tabor et al., 2019).
grin2B-/- larvae (n = 9) had no significant changes in gross brain size (106% the size of grin2B controls (n=13)), or overall signal from excitatory or inhibitory neurons (99 and 92% the signal respectively of controls). Upon subdividing the brain into major divisions, however, we found a significant 20.2% decrease in the mean inhibitory neuron signal in the subpallium (Figure 7A). To examine this more closely, we mapped voxel-level differences in inhibitory neuron signal to coronal sections through different parts of the subpallium, reconstructed from confocal images (Figure 7B). As for many other zebrafish brain regions, the subpallium has cell-rich and neuropil-rich zones. A significant reduction in the inhibitory neuron signal was present in the cell-rich anterior subpallial domain (Figure 7C). However, greater reductions were seen in subpallial areas posterior to this region, encompassing the anterior commissure (Figure 7D) and the lateral forebrain bundle, which is adjacent to the preoptic region (Figure 7E). These findings highlight inhibitory neuron populations in specific subpallial brain regions as a key alteration caused by developmental lack of GluN2B.
GRIN2B is a high-confidence ASD-associated gene in ASD (O'Roak, Vives, Fu, et al., 2012; O'Roak, Vives, Girirajan, et al., 2012; Satterstrom et al., 2020). How it contributes to clinical phenotypes, however, is poorly understood. In addition to well-studied functions for NMDARs in synaptic transmission at mature excitatory synapses, NMDARs also play key roles in development (Chakraborty et al., 2017). NMDARs regulate neurogenesis (Nacher & McEwen, 2006), cell migration (Namba et al., 2011) and neuronal differentiation (Bell et al., 2018). Here, we establish zebrafish as an in vivo model to study GluN2B in development and dysfunction. Unlike mouse knockouts for GRIN2B, which fail to suckle and die shortly after birth (Kutsuwada et al., 1996), zebrafish lacking GluN2B (grin2B-/- fish) survive into adulthood and are fertile (Fig. 2). Notably, many aspects of these grin2B-/- fish appear normal including movement (Fig. 5A-C) and learning (Fig. 5E-F) which may be driven by the compensational expression of other NMDAR genes (Fig. 6). Nevertheless, one behavior – a juvenile social preference – is deficient in grin2B-/- fish (Fig. 3). Social deficits are common in ASD patients, and the specificity of this behavioral phenotype in this model is a powerful tool to study grin2B in brain dysfunction. Altered excitatory/inhibitory (E/I) balance, often caused by reductions in inhibitory neuron populations, is central to ASD pathogenesis (Bruining et al., 2020; Contractor et al., 2021). We did not see dramatic changes in E/I balance when globally observing the brain in grin2B-/- fish (Fig. 7). However, we observed a significant reduction in inhibitory neuron signals in the subpallium, a region that will later mature into putative homologues of amygdaloid, septal, and striatal nuclei, all structures previously implicated in ASD (Fuccillo, 2016; Horiai et al., 2020; Janouschek et al., 2021; Shen et al., 2022).
Due to an ancient genome duplication, zebrafish have two grin2B paralogues (grin2Ba and grin2Bb) (Amores et al., 1998). Proteins generated from both paralogues share considerable sequence homology with each other and human GluN2B (hGluN2B), only diverging in sequence in the amino terminal (ATD) and carboxy-terminal (CTD) domains (Fig. 1). The CTD is the region of greatest variance in sequence and length amongst NMDAR subunits of the same species and is involved in intracellular signaling (Paoletti et al., 2013). Despite this, zebrafish GluN2B proteins interact with various conserved intracellular components, including Ca2+/calmodulin dependent protein kinase (CAMKII) (Roy, Ferdous, & Ali, 2015) and ERK (Krapivinsky et al., 2003). As suggested by the conservation in sequence in ligand-binding, transmembrane, and pore-forming domains, zGluN2Bb formed functional heterotetramers with hGluN1 in a heterologous expression system (Fig. 1C). These cross-species NMDARs showed glutamate-gated inward current and had prolonged deactivation, a hallmark of GluN2B-containing NMDARs (Fig. 1E). These results demonstrate a high degree of functional similarity between human and zebrafish GluN2B proteins.
Zebrafish are social creatures. Non-specific block of all NMDARs with MK-801 decreases social preference in juveniles (Dreosti et al., 2015; Sison & Gerlai, 2011) and adults (Sison & Gerlai, 2011; Zimmermann, Gaspary, Siebel, & Bonan, 2016). Our findings refine this pharmacological work by implicating GluN2B, rather than general NMDAR dysfunction, in the development of social preference (Fig. 3D). Additionally, acute pharmacological block precludes the understanding of any developmental roles of NMDARs. MK-801-driven disruptions in movement control may underlie observed social deficits in these assays (Dreosti et al., 2015; Sison & Gerlai, 2011; Zoodsma et al., 2020). Our findings suggest that developmental alterations in specific brain regions, rather than alterations in movement control (Fig. 5), are likely generating these phenotypes.
Disease-associated missense mutations in GRIN2B are more likely to result in neurodevelopmental disorders, such as ASD, as compared to other subunits, highlighting the significant developmental requirements for GluN2B (Myers et al., 2019). Interestingly, although not as numerous as in GluN2B, rare variants associated with ASD are also found in GluN1, GluN2A, GluN2C and GluN2D (XiangWei, Jiang, & Yuan, 2018). Zebrafish lacking other NMDAR subunit paralogues (grin1a, grin1b, grin2Aa/b, grin2Da, or grin2Db) did not result in a social deficit. Given this lack of social behavioral phenotype, mutations in other subunits may confer some effects through association with GluN2B, possibly in triheteromeric receptors.
Behavior and cellular phenotypes of fmr1 mutant fish have been previously studied (Constantin et al., 2020; den Broeder et al., 2009; Marquez-Legorreta et al., 2022). Interestingly, our findings on fmr1 social deficits (Fig. 4A-B) differ from previous studies which report fmr1 mutant zebrafish developing social preference earlier and more robustly than wild-type (Wu et al., 2017). These studies use a different social behavior paradigm that may be more influenced by well-documented hyper-activity in fmr1 mutant zebrafish (Kim et al., 2014; Wu et al., 2017).
Zebrafish lacking GluN2B displayed wild type spontaneous swimming, visual motor response, photic startle responses, and could capture paramecia, albeit at a slightly diminished capacity (Fig. 5). Further, these fish were capable of learning within the prey capture paradigm (Fig. 5F). One possibility is that synaptic plasticity mediated by GluN2B-containing NMDARs is not essential to learning the prey capture task. Alternatively, the action of other NMDARs, such as those containing GluN2A or GluN2D can compensate for the lack of GluN2B. Indeed, in rodents, increase in levels of GluN1 and GluN2A were observed during memory consolidation, while GluN2B levels remained unaltered (Cercato et al., 2016).
NMD of mutant RNA can result in transcriptional adaptation (El-Brolosy et al., 2019). Compensatory increases in other NMDAR subunits were observed in our assays (Fig. 6) and may contribute to both the viability of the grin2B−/− fish into adulthood, as well as their wild-type spontaneous locomotion, photic-evoked responses, and capacity to learn in prey capture assays. These findings, however, further highlight the specificity of GluN2B in the development of social behavior, as upregulation of other NMDAR subunits is not sufficient to rescue this phenotype.
Whole-brain scans of zebrafish larvae lacking GluN2B and containing transgenic lines labeling excitatory and inhibitory populations outlined no structural or whole-brain changes in neuronal populations. Similar whole-brain larval confocal scans have been done on valproic acid (VPA)-treated fish (Gupta et al., 2018). VPA-exposure in zebrafish also causes social deficits (Chen et al., 2018; Zimmermann, Gaspary, Leite, De Paula Cognato, & Bonan, 2015) and is associated with increased risk of ASD in humans (Chomiak, Turner, & Hu, 2013; Christensen et al., 2013). Unsurprisingly, due to the broad disruption caused by global VPA-treatment, gross structural and compositional changes were reported in many regions (Gupta et al., 2018). Given the shared social phenotype of VPA-treated and grin2B−/− fish, our model offers a more refined view of the potential regions involved in establishing this phenotype. In particular, we observed a significant reduction in the intensity of the marker labeling inhibitory neurons in the subpallium of 6 dpf larvae. Changes were apparent in a cell-rich anterior domain and in neuropil-rich regions surrounding the preoptic area.
Nuclei of the precommissural subpallium are outlined on a schematic coronal section of the telencephalon (Supplemental Fig. 8). At this stage, major regions of the forebrain are not yet mature, however, neurons derived from the subpallium later contribute to putative zebrafish homologues of the amygdala, septum, and striatum (Ganz et al., 2012; Porter & Mueller, 2020; Wullimann & Rink, 2002) (Supplemental Table 5). While precise homologies of specific zebrafish nuclei remain unresolved, there are indisputably domains of the zebrafish ventral telencephalon (subpallium) that molecularly and functionally represent these structures. Our data suggest that changes in these regions may underlie the abnormal social behavior observed in 3–4 weeks old grin2B−/− fish. Abnormalities in amygdalar, septal, and striatal development and function have been implicated in ASD and are thought to contribute to the social impairment that characterizes this disorder (Fuccillo, 2016; Horiai et al., 2020; Janouschek et al., 2021; Shen et al., 2022). Given the autonomic dysfunction and sensory processing atypia associated with ASD, it is unsurprising that we also uncovered substantial differences in inhibitory neuron signal in additional anatomical areas related to these functions (Levit-Binnun, Davidovitch, & Golland, 2013; Owens, Mathias, & Iodice, 2021; Suarez, Gobius, & Richards, 2014). These findings and their associations warrant further investigation.
We establish zebrafish as a clinically relevant model for investigating developmental roles of GluN2B. The viability, homology, and ability to assay social preference together facilitate the study of GluN2B in development and ASD etiology. Given the myriad roles of NMDAR in development, further study into the specific mechanisms by which GluN2B perturbation gives rise to the ASD phenotype are necessary. These should include effects on neurogenesis, connectivity, and synaptic alterations with a specific focus on the nuclei of the subpallium. In addition to knock-out models, the advent of precise gene-editing in zebrafish (Petri et al., 2021), coupled with the high homology of GluN2B in zebrafish, facilitates the future study of ASD-associated GluN2B missense mutations in zebrafish.
Ethics approval and Consent: Not applicable
Consent for publication: Not applicable
Availability of data and materials: Please contact author for data requests.
Funding: This work was supported by NIH grants 5R03HD101767-02 to HIS and LPW and R01NS088479 to LPW. AB and HB were supported by the Intramural Research Program of the Eunice Kennedy Shriver National Institute for Child Health and Human Development (NICHD).
Competing interests: The authors declare that they have no competing interests.
Authors’ contributions: L.P.W and H.I.S wrote the manuscript. G.M and J.D.Z prepared Figure 1. J.D.Z prepared figures 2-6. J.D.Z, A.A.B, A.J.N and H.A.B prepared figure 7 and the related supplementary data. All authors reviewed the manuscript.
Al-Beltagi, M. (2021). Autism medical comorbidities. World J Clin Pediatr, 10(3), 15-28. doi:10.5409/wjcp.v10.i3.15
Alsaloum, M., Kazi, R., Gan, Q., Amin, J., & Wollmuth, L. P. (2016). A Molecular Determinant of Subtype-Specific Desensitization in Ionotropic Glutamate Receptors. J Neurosci, 36(9), 2617-2622. doi:10.1523/JNEUROSCI.2667-15.2016
American Psychiatric Association. (2013). Diagnostic and Statistical Manual of Mental Disorders (5th ed.). Washington, DC.
Amin, J. B., Leng, X., Gochman, A., Zhou, H. X., & Wollmuth, L. P. (2018). A conserved glycine harboring disease-associated mutations permits NMDA receptor slow deactivation and high Ca(2+) permeability. Nat Commun, 9(1), 3748. doi:10.1038/s41467-018-06145-w
Amin, J. B., Salussolia, C. L., Chan, K., Regan, M. C., Dai, J., Zhou, H. X., . . . Wollmuth, L. P. (2017). Divergent roles of a peripheral transmembrane segment in AMPA and NMDA receptors. J Gen Physiol, 149(6), 661-680. doi:10.1085/jgp.201711762
Amores, A., Force, A., Yan, Y. L., Joly, L., Amemiya, C., Fritz, A., . . . Postlethwait, J. H. (1998). Zebrafish hox clusters and vertebrate genome evolution. Science, 282(5394), 1711-1714. doi:10.1126/science.282.5394.1711
Bagasrawala, I., Memi, F., N, V. R., & Zecevic, N. (2017). N-Methyl d-Aspartate Receptor Expression Patterns in the Human Fetal Cerebral Cortex. Cereb Cortex, 27(11), 5041-5053. doi:10.1093/cercor/bhw289
Baio, J., Wiggins, L., Christensen, D. L., Maenner, M. J., Daniels, J., Warren, Z., . . . Dowling, N. F. (2018). Prevalence of Autism Spectrum Disorder Among Children Aged 8 Years - Autism and Developmental Disabilities Monitoring Network, 11 Sites, United States, 2014. MMWR Surveill Summ, 67(6), 1-23. doi:10.15585/mmwr.ss6706a1
Bell, S., Maussion, G., Jefri, M., Peng, H., Theroux, J. F., Silveira, H., . . . Ernst, C. (2018). Disruption of GRIN2B Impairs Differentiation in Human Neurons. Stem Cell Reports, 11(1), 183-196. doi:10.1016/j.stemcr.2018.05.018
Brodkin, E. S. (2008). Social behavior phenotypes in fragile X syndrome, autism, and the Fmr1 knockout mouse: theoretical comment on McNaughton et al. (2008). Behav Neurosci, 122(2), 483-489. doi:10.1037/0735-7044.122.2.483
Bruining, H., Hardstone, R., Juarez-Martinez, E. L., Sprengers, J., Avramiea, A. E., Simpraga, S., . . . Linkenkaer-Hansen, K. (2020). Measurement of excitation-inhibition ratio in autism spectrum disorder using critical brain dynamics. Sci Rep, 10(1), 9195. doi:10.1038/s41598-020-65500-4
Burgess, H. A., & Granato, M. (2007). Modulation of locomotor activity in larval zebrafish during light adaptation. J Exp Biol, 210(Pt 14), 2526-2539. doi:10.1242/jeb.003939
Cercato, M. C., Vazquez, C. A., Kornisiuk, E., Aguirre, A. I., Colettis, N., Snitcofsky, M., . . . Baez, M. V. (2016). GluN1 and GluN2A NMDA Receptor Subunits Increase in the Hippocampus during Memory Consolidation in the Rat. Front Behav Neurosci, 10, 242. doi:10.3389/fnbeh.2016.00242
Chakraborty, A., Murphy, S., & Coleman, N. (2017). The Role of NMDA Receptors in Neural Stem Cell Proliferation and Differentiation. Stem Cells Dev, 26(11), 798-807. doi:10.1089/scd.2016.0325
Chang, N., Sun, C., Gao, L., Zhu, D., Xu, X., Zhu, X., . . . Xi, J. J. (2013). Genome editing with RNA-guided Cas9 nuclease in zebrafish embryos. Cell Res, 23(4), 465-472. doi:10.1038/cr.2013.45
Chen, J., Lei, L., Tian, L., Hou, F., Roper, C., Ge, X., . . . Huang, C. (2018). Developmental and behavioral alterations in zebrafish embryonically exposed to valproic acid (VPA): An aquatic model for autism. Neurotoxicol Teratol, 66, 8-16. doi:10.1016/j.ntt.2018.01.002
Chomiak, T., Turner, N., & Hu, B. (2013). What We Have Learned about Autism Spectrum Disorder from Valproic Acid. Patholog Res Int, 2013, 712758. doi:10.1155/2013/712758
Christensen, J., Gronborg, T. K., Sorensen, M. J., Schendel, D., Parner, E. T., Pedersen, L. H., & Vestergaard, M. (2013). Prenatal valproate exposure and risk of autism spectrum disorders and childhood autism. JAMA, 309(16), 1696-1703. doi:10.1001/jama.2013.2270
Clemens, A. M., & Brecht, M. (2021). Neural representations of kinship. Curr Opin Neurobiol, 68, 116-123. doi:10.1016/j.conb.2021.02.007
Constantin, L., Poulsen, R. E., Scholz, L. A., Favre-Bulle, I. A., Taylor, M. A., Sun, B., . . . Scott, E. K. (2020). Altered brain-wide auditory networks in a zebrafish model of fragile X syndrome. BMC Biol, 18(1), 125. doi:10.1186/s12915-020-00857-6
Contractor, A., Ethell, I. M., & Portera-Cailliau, C. (2021). Cortical interneurons in autism. Nat Neurosci, 24(12), 1648-1659. doi:10.1038/s41593-021-00967-6
Courchesne, E., Pramparo, T., Gazestani, V. H., Lombardo, M. V., Pierce, K., & Lewis, N. E. (2019). The ASD Living Biology: from cell proliferation to clinical phenotype. Mol Psychiatry, 24(1), 88-107. doi:10.1038/s41380-018-0056-y
Cox, J. A., Kucenas, S., & Voigt, M. M. (2005). Molecular characterization and embryonic expression of the family of N-methyl-D-aspartate receptor subunit genes in the zebrafish. Dev Dyn, 234(3), 756-766. doi:10.1002/dvdy.20532
De Rubeis, S., & Buxbaum, J. D. (2015). Recent advances in the genetics of autism spectrum disorder. Curr Neurol Neurosci Rep, 15(6), 36. doi:10.1007/s11910-015-0553-1
den Broeder, M. J., van der Linde, H., Brouwer, J. R., Oostra, B. A., Willemsen, R., & Ketting, R. F. (2009). Generation and characterization of FMR1 knockout zebrafish. PLoS One, 4(11), e7910. doi:10.1371/journal.pone.0007910
Dreosti, E., Lopes, G., Kampff, A. R., & Wilson, S. W. (2015). Development of social behavior in young zebrafish. Front Neural Circuits, 9, 39. doi:10.3389/fncir.2015.00039
El-Brolosy, M. A., Kontarakis, Z., Rossi, A., Kuenne, C., Gunther, S., Fukuda, N., . . . Stainier, D. Y. R. (2019). Genetic compensation triggered by mutant mRNA degradation. Nature, 568(7751), 193-197. doi:10.1038/s41586-019-1064-z
Emran, F., Rihel, J., & Dowling, J. E. (2008). A behavioral assay to measure responsiveness of zebrafish to changes in light intensities. J Vis Exp(20). doi:10.3791/923
Fedele, L., Newcombe, J., Topf, M., Gibb, A., Harvey, R. J., & Smart, T. G. (2018). Disease-associated missense mutations in GluN2B subunit alter NMDA receptor ligand binding and ion channel properties. Nat Commun, 9(1), 957. doi:10.1038/s41467-018-02927-4
Fombonne, E. (2009). A wrinkle in time: from early signs to a diagnosis of autism. J Am Acad Child Adolesc Psychiatry, 48(5), 463-464. doi:10.1097/CHI.0b013e31819e40c0
Fontana, B. D., Muller, T. E., Cleal, M., de Abreu, M. S., Norton, W. H. J., Demin, K. A., . . . Rosemberg, D. B. (2022). Using zebrafish (Danio rerio) models to understand the critical role of social interactions in mental health and wellbeing. Prog Neurobiol, 208, 101993. doi:10.1016/j.pneurobio.2021.101993
Fuccillo, M. V. (2016). Striatal Circuits as a Common Node for Autism Pathophysiology. Front Neurosci, 10, 27. doi:10.3389/fnins.2016.00027
Ganz, J., Kaslin, J., Freudenreich, D., Machate, A., Geffarth, M., & Brand, M. (2012). Subdivisions of the adult zebrafish subpallium by molecular marker analysis. J Comp Neurol, 520(3), 633-655. doi:10.1002/cne.22757
Geisheker, M. R., Heymann, G., Wang, T., Coe, B. P., Turner, T. N., Stessman, H. A. F., . . . Eichler, E. E. (2017). Hotspots of missense mutation identify neurodevelopmental disorder genes and functional domains. Nat Neurosci, 20(8), 1043-1051. doi:10.1038/nn.4589
Geng, Y., Zhang, T., Godar, S. C., Pluimer, B. R., Harrison, D. L., Nath, A. K., . . . Peterson, R. T. (2021). Top2a promotes the development of social behavior via PRC2 and H3K27me3. bioRxiv.
Ghanem, N., Jarinova, O., Amores, A., Long, Q., Hatch, G., Park, B. K., . . . Ekker, M. (2003). Regulatory roles of conserved intergenic domains in vertebrate Dlx bigene clusters. Genome Res, 13(4), 533-543. doi:10.1101/gr.716103
Gupta, T., Marquart, G. D., Horstick, E. J., Tabor, K. M., Pajevic, S., & Burgess, H. A. (2018). Morphometric analysis and neuroanatomical mapping of the zebrafish brain. Methods, 150, 49-62. doi:10.1016/j.ymeth.2018.06.008
Hansen, K. B., Wollmuth, L. P., Bowie, D., Furukawa, H., Menniti, F. S., Sobolevsky, A. I., . . . Traynelis, S. F. (2021). Structure, Function, and Pharmacology of Glutamate Receptor Ion Channels. Pharmacol Rev, 73(4), 298-487. doi:10.1124/pharmrev.120.000131
Hardingham, G. E., & Do, K. Q. (2016). Linking early-life NMDAR hypofunction and oxidative stress in schizophrenia pathogenesis. Nat Rev Neurosci, 17(2), 125-134. doi:10.1038/nrn.2015.19
Ho, J., Tumkaya, T., Aryal, S., Choi, H., & Claridge-Chang, A. (2019). Moving beyond P values: data analysis with estimation graphics. Nat Methods, 16(7), 565-566. doi:10.1038/s41592-019-0470-3
Horiai, M., Otsuka, A., Hidema, S., Hiraoka, Y., Hayashi, R., Miyazaki, S., . . . Nishimori, K. (2020). Targeting oxytocin receptor (Oxtr)-expressing neurons in the lateral septum to restore social novelty in autism spectrum disorder mouse models. Sci Rep, 10(1), 22173. doi:10.1038/s41598-020-79109-0
Hu, C., Chen, W., Myers, S. J., Yuan, H., & Traynelis, S. F. (2016). Human GRIN2B variants in neurodevelopmental disorders. J Pharmacol Sci, 132(2), 115-121. doi:10.1016/j.jphs.2016.10.002
Hunt, D. L., & Castillo, P. E. (2012). Synaptic plasticity of NMDA receptors: mechanisms and functional implications. Curr Opin Neurobiol, 22(3), 496-508. doi:10.1016/j.conb.2012.01.007
Hwang, W. Y., Fu, Y., Reyon, D., Maeder, M. L., Tsai, S. Q., Sander, J. D., . . . Joung, J. K. (2013). Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol, 31(3), 227-229. doi:10.1038/nbt.2501
Iossifov, I., Ronemus, M., Levy, D., Wang, Z., Hakker, I., Rosenbaum, J., . . . Wigler, M. (2012). De novo gene disruptions in children on the autistic spectrum. Neuron, 74(2), 285-299. doi:10.1016/j.neuron.2012.04.009
Janouschek, H., Chase, H. W., Sharkey, R. J., Peterson, Z. J., Camilleri, J. A., Abel, T., . . . Nickl-Jockschat, T. (2021). The functional neural architecture of dysfunctional reward processing in autism. Neuroimage Clin, 31, 102700. doi:10.1016/j.nicl.2021.102700
Kim, L., He, L., Maaswinkel, H., Zhu, L., Sirotkin, H., & Weng, W. (2014). Anxiety, hyperactivity and stereotypy in a zebrafish model of fragile X syndrome and autism spectrum disorder. Prog Neuropsychopharmacol Biol Psychiatry, 55, 40-49. doi:10.1016/j.pnpbp.2014.03.007
Kinkhabwala, A., Riley, M., Koyama, M., Monen, J., Satou, C., Kimura, Y., . . . Fetcho, J. (2011). A structural and functional ground plan for neurons in the hindbrain of zebrafish. Proc Natl Acad Sci U S A, 108(3), 1164-1169. doi:10.1073/pnas.1012185108
Krapivinsky, G., Krapivinsky, L., Manasian, Y., Ivanov, A., Tyzio, R., Pellegrino, C., . . . Medina, I. (2003). The NMDA receptor is coupled to the ERK pathway by a direct interaction between NR2B and RasGRF1. Neuron, 40(4), 775-784. doi:10.1016/s0896-6273(03)00645-7
Kutsuwada, T., Sakimura, K., Manabe, T., Takayama, C., Katakura, N., Kushiya, E., . . . Mishina, M. (1996). Impairment of suckling response, trigeminal neuronal pattern formation, and hippocampal LTD in NMDA receptor epsilon 2 subunit mutant mice. Neuron, 16(2), 333-344. doi:10.1016/s0896-6273(00)80051-3
Lai, M. C., Lombardo, M. V., & Baron-Cohen, S. (2014). Autism. Lancet, 383(9920), 896-910. doi:10.1016/S0140-6736(13)61539-1
Levit-Binnun, N., Davidovitch, M., & Golland, Y. (2013). Sensory and motor secondary symptoms as indicators of brain vulnerability. J Neurodev Disord, 5(1), 26. doi:10.1186/1866-1955-5-26
Marquart, G. D., Tabor, K. M., Brown, M., Strykowski, J. L., Varshney, G. K., LaFave, M. C., . . . Burgess, H. A. (2015). A 3D Searchable Database of Transgenic Zebrafish Gal4 and Cre Lines for Functional Neuroanatomy Studies. Front Neural Circuits, 9, 78. doi:10.3389/fncir.2015.00078
Marquez-Legorreta, E., Constantin, L., Piber, M., Favre-Bulle, I. A., Taylor, M. A., Blevins, A. S., . . . Scott, E. K. (2022). Brain-wide visual habituation networks in wild type and fmr1 zebrafish. Nat Commun, 13(1), 895. doi:10.1038/s41467-022-28299-4
Myers, S. J., Yuan, H., Kang, J. Q., Tan, F. C. K., Traynelis, S. F., & Low, C. M. (2019). Distinct roles of GRIN2A and GRIN2B variants in neurological conditions. F1000Res, 8. doi:10.12688/f1000research.18949.1
Nacher, J., & McEwen, B. S. (2006). The role of N-methyl-D-asparate receptors in neurogenesis. Hippocampus, 16(3), 267-270. doi:10.1002/hipo.20160
Namba, T., Ming, G. L., Song, H., Waga, C., Enomoto, A., Kaibuchi, K., . . . Uchino, S. (2011). NMDA receptor regulates migration of newly generated neurons in the adult hippocampus via Disrupted-In-Schizophrenia 1 (DISC1). J Neurochem, 118(1), 34-44. doi:10.1111/j.1471-4159.2011.07282.x
O'Roak, B. J., Vives, L., Fu, W., Egertson, J. D., Stanaway, I. B., Phelps, I. G., . . . Shendure, J. (2012). Multiplex targeted sequencing identifies recurrently mutated genes in autism spectrum disorders. Science, 338(6114), 1619-1622. doi:10.1126/science.1227764
O'Roak, B. J., Vives, L., Girirajan, S., Karakoc, E., Krumm, N., Coe, B. P., . . . Eichler, E. E. (2012). Sporadic autism exomes reveal a highly interconnected protein network of de novo mutations. Nature, 485(7397), 246-250. doi:10.1038/nature10989
Oldfield, C. S., Grossrubatscher, I., Chavez, M., Hoagland, A., Huth, A. R., Carroll, E. C., . . . Isacoff, E. Y. (2020). Experience, circuit dynamics, and forebrain recruitment in larval zebrafish prey capture. Elife, 9. doi:10.7554/eLife.56619
Owens, A. P., Mathias, C. J., & Iodice, V. (2021). Autonomic Dysfunction in Autism Spectrum Disorder. Front Integr Neurosci, 15, 787037. doi:10.3389/fnint.2021.787037
Paoletti, P., Bellone, C., & Zhou, Q. (2013). NMDA receptor subunit diversity: impact on receptor properties, synaptic plasticity and disease. Nat Rev Neurosci, 14(6), 383-400. doi:10.1038/nrn3504
Porter, B. A., & Mueller, T. (2020). The Zebrafish Amygdaloid Complex - Functional Ground Plan, Molecular Delineation, and Everted Topology. Front Neurosci, 14, 608. doi:10.3389/fnins.2020.00608
Preibisch, S., Saalfeld, S., & Tomancak, P. (2009). Globally optimal stitching of tiled 3D microscopic image acquisitions. Bioinformatics, 25(11), 1463-1465. doi:10.1093/bioinformatics/btp184
Rea, V., & Van Raay, T. J. (2020). Using Zebrafish to Model Autism Spectrum Disorder: A Comparison of ASD Risk Genes Between Zebrafish and Their Mammalian Counterparts. Front Mol Neurosci, 13, 575575. doi:10.3389/fnmol.2020.575575
Roman-Urrestarazu, A., van Kessel, R., Allison, C., Matthews, F. E., Brayne, C., & Baron-Cohen, S. (2021). Association of Race/Ethnicity and Social Disadvantage With Autism Prevalence in 7 Million School Children in England. JAMA Pediatr, 175(6), e210054. doi:10.1001/jamapediatrics.2021.0054
Roy, B., Ferdous, J., & Ali, D. W. (2015). NMDA receptors on zebrafish Mauthner cells require CaMKII-alpha for normal development. Dev Neurobiol, 75(2), 145-162. doi:10.1002/dneu.22214
Satterstrom, F. K., Kosmicki, J. A., Wang, J., Breen, M. S., De Rubeis, S., An, J. Y., . . . Buxbaum, J. D. (2020). Large-Scale Exome Sequencing Study Implicates Both Developmental and Functional Changes in the Neurobiology of Autism. Cell, 180(3), 568-584 e523. doi:10.1016/j.cell.2019.12.036
Semmelhack, J. L., Donovan, J. C., Thiele, T. R., Kuehn, E., Laurell, E., & Baier, H. (2014). A dedicated visual pathway for prey detection in larval zebrafish. Elife, 3. doi:10.7554/eLife.04878
Shen, M. D., Swanson, M. R., Wolff, J. J., Elison, J. T., Girault, J. B., Kim, S. H., . . . Network, I. (2022). Subcortical Brain Development in Autism and Fragile X Syndrome: Evidence for Dynamic, Age- and Disorder-Specific Trajectories in Infancy. Am J Psychiatry, appiajp21090896. doi:10.1176/appi.ajp.21090896
Sison, M., & Gerlai, R. (2011). Behavioral performance altering effects of MK-801 in zebrafish (Danio rerio). Behav Brain Res, 220(2), 331-337. doi:10.1016/j.bbr.2011.02.019
Stessman, H. A., Xiong, B., Coe, B. P., Wang, T., Hoekzema, K., Fenckova, M., . . . Eichler, E. E. (2017). Targeted sequencing identifies 91 neurodevelopmental-disorder risk genes with autism and developmental-disability biases. Nat Genet, 49(4), 515-526. doi:10.1038/ng.3792
Suarez, R., Gobius, I., & Richards, L. J. (2014). Evolution and development of interhemispheric connections in the vertebrate forebrain. Front Hum Neurosci, 8, 497. doi:10.3389/fnhum.2014.00497
Tabor, K. M., Marquart, G. D., Hurt, C., Smith, T. S., Geoca, A. K., Bhandiwad, A. A., . . . Burgess, H. A. (2019). Brain-wide cellular resolution imaging of Cre transgenic zebrafish lines for functional circuit-mapping. Elife, 8. doi:10.7554/eLife.42687
Uzunova, G., Pallanti, S., & Hollander, E. (2016). Excitatory/inhibitory imbalance in autism spectrum disorders: Implications for interventions and therapeutics. World J Biol Psychiatry, 17(3), 174-186. doi:10.3109/15622975.2015.1085597
Wollmuth, L. P., & Sobolevsky, A. I. (2004). Structure and gating of the glutamate receptor ion channel. Trends Neurosci, 27(6), 321-328. doi:10.1016/j.tins.2004.04.005
Wu, Y. J., Hsu, M. T., Ng, M. C., Amstislavskaya, T. G., Tikhonova, M. A., Yang, Y. L., & Lu, K. T. (2017). Fragile X Mental Retardation-1 Knockout Zebrafish Shows Precocious Development in Social Behavior. Zebrafish, 14(5), 438-443. doi:10.1089/zeb.2017.1446
Wullimann, M. F., & Rink, E. (2002). The teleostean forebrain: a comparative and developmental view based on early proliferation, Pax6 activity and catecholaminergic organization. Brain Res Bull, 57(3-4), 363-370. doi:10.1016/s0361-9230(01)00666-9
XiangWei, W., Jiang, Y., & Yuan, H. (2018). De Novo Mutations and Rare Variants Occurring in NMDA Receptors. Curr Opin Physiol, 2, 27-35. doi:10.1016/j.cophys.2017.12.013
Yelshansky, M. V., Sobolevsky, A. I., Jatzke, C., & Wollmuth, L. P. (2004). Block of AMPA receptor desensitization by a point mutation outside the ligand-binding domain. J Neurosci, 24(20), 4728-4736. doi:10.1523/JNEUROSCI.0757-04.2004
Yuan, H., Low, C. M., Moody, O. A., Jenkins, A., & Traynelis, S. F. (2015). Ionotropic GABA and Glutamate Receptor Mutations and Human Neurologic Diseases. Mol Pharmacol, 88(1), 203-217. doi:10.1124/mol.115.097998
Zeidan, J., Fombonne, E., Scorah, J., Ibrahim, A., Durkin, M. S., Saxena, S., . . . Elsabbagh, M. (2022). Global prevalence of autism: A systematic review update. Autism Res, 15(5), 778-790. doi:10.1002/aur.2696
Zimmermann, F. F., Gaspary, K. V., Leite, C. E., De Paula Cognato, G., & Bonan, C. D. (2015). Embryological exposure to valproic acid induces social interaction deficits in zebrafish (Danio rerio): A developmental behavior analysis. Neurotoxicol Teratol, 52(Pt A), 36-41. doi:10.1016/j.ntt.2015.10.002
Zimmermann, F. F., Gaspary, K. V., Siebel, A. M., & Bonan, C. D. (2016). Oxytocin reversed MK-801-induced social interaction and aggression deficits in zebrafish. Behav Brain Res, 311, 368-374. doi:10.1016/j.bbr.2016.05.059
Zoodsma, J. D., Chan, K., Bhandiwad, A. A., Golann, D., Liu, G., Syed, S., . . . Wollmuth, L. P. (2020). A Model to Study NMDA Receptors in Early Nervous System Development. J Neurosci. doi:10.1523/JNEUROSCI.3025-19.2020
No competing interests reported.