Materials
Q5 High-Fidelity Master Mix with GC-buffer was purchased from NEB. Restriction endonucleases, Miniprep, and Gel Extraction kits were purchased from TaKaRa Biotechnology Co. Ltd. 5-Fluorocytosine (5FC) was purchased from Aladdin. Oligonucleotide primer synthesis and DNA sequencing of PCR products were performed by Shanghai Sunny Biotechnology Co. Ltd. China.
Strains, plasmids, and primers
The strains and plasmids used in this study are listed in Table 1. Strains were used as follows: Rimocidin producer S. rimosus M527 has been deposited in the China Center for Type Culture Collection (CCTCC: M2013270). Act producer S. coelicolor M145 was provided by Prof. Andreas Bechthold (University of Freiburg, Freiburg, Germany). TM producer S. diastatochromogenes 1628 has been deposited in the China General Microbiological Culture Collection Center (CGMCC No. 2060) [37]. Escherichia coli JM109 was used as a general host for gene cloning and plasmid construction. Methylation-deficient strain, E. coli ET12567/pUZ8002, was used as the donor for plasmid transfer to Streptomyces by intergeneric conjugation.
Table 1 Strains and plasmids used in this study
Strain or plasmid
|
Description
|
Source or reference
|
Strain
|
|
|
E. coli JM109
|
General cloning host
|
Our lab
|
E. coli ET12567/pUZ8002
|
Cmr, Kmr, donor strain for conjugation
|
Our lab
|
S. rimosus M527
|
Rimocidin producer
|
CCTCC 2013270
|
S. diastatochromogenes 1628
|
Toyocamycin producer
|
CGMCC 2060
|
S. coelicolor M145
|
Actinorhodin producer
|
Prof. Andreas
|
M527-ΔnsdAsr
|
nsdAsr gene deletion mutant, derived from M527 strain
|
This work
|
M527-ΔnsdAsr/pSET152::nsdAsr
|
nsdAsr complemented strain, mutant M527-ΔnsdAsr with integrative plasmid pSET152::nsdAsr
|
This work
|
M527-NAsr
|
M527 with integrative vector pIB139-nsdAsr
|
This work
|
M145-NAsr
|
M145 with integrative vector pIB139-nsdAsr
|
This work
|
1628-NAsr
|
1628 with integrative vector pIB139-nsdAsr
|
This work
|
Plasmids
|
|
|
pSET152
|
Integrative plasmid, aprr, oriTRK2, φC31 int/attP
|
Our lab
|
pIB139
|
Derivative of integrative plasmid pSET152, harboring a PermE* promoter, aprr ,oriTRK2, φC31 int/attP
|
Our lab
|
pWHU2653
|
Scas9, sgRNA cloning cassette, codA(sm), aprr , ori(coEl)
|
[34]
|
pWHU2653-△nsdAsr
|
Derived from pWHU2653, for deletion of nsdAsr, containing up- and down-stream homologous arms of nsdAsr
|
This work
|
pSET152::nsdAsr
|
Derived from pSET152, harboring nsdAsr driven by its own promoter
|
This work
|
pIB139-nsdAsr
|
nsdAsr gene under the control of promoter PermE* in pIB139
|
This work
|
Plasmid pWHU2653 [34], a gift from Prof. Sun YH, was used for disruption of the nsdAsr gene using the CRISPR/Cas9 system. The primers (restriction sites are underlined) used in this study are listed in Table 2.
Table 2 Primers used in this study
Primers
|
Description
|
Source or reference
|
P1
|
5’-CACCACCACCACTGAGCTAGCTTCAGACGTGTCTA-3’
|
This work
|
P2
|
5’-TCCGTGTCCGGCGTCGACCTGCTGGATCCT-3’
|
This work
|
P3
|
5’-AGGTCGACGCCGGACACGGAGTTTTAGAGC-3’
|
This work
|
P4
|
5’-GTCGACTAGAGGATCCCCGGGTATCTAGAAA-3’
|
This work
|
P5
|
5’-CGTCGACCTGCAGGCATGCAAGCTTCGCGTCGTCCACCAGCACCTCG-3’
|
This work
|
P6
|
5’-AATCGGAATGGGGGCGTTCCACAGCACTCCCACAGACCCCGG-3’
|
This work
|
P7
|
5’-GGTCTGTGGGAGTGCTGTGGAACGCCCCCATTCCGATTGC-3’
|
This work
|
P8
|
5’-GAGTGCTTGCGGCAGCGTGAAGCTTGGCATGGTCGGCCTTACGGACAG-3’
|
This work
|
P9
|
5’-ACCGCATATGGTGGGCGGCAGTGGCGGCAC-3’ (NdeI)
|
This work
|
P10
|
5’-ACCGTCTAGATTATCAGACGGCCTCCGCGCCGG-3’ (XbaI)
|
This work
|
P11
|
5’-ACCGCATATGCGGCAGCCGGACCGAGCAGT-3’ (NdeI)
|
This work
|
Primers P1-P4 were used for amplification of sgRNA. Primers P5 and P6 were used for amplification of up-stream homologous arms of nsdAsr. Primers P7 and P8 were used for amplification of down-stream homologous arms of nsdAsr. Primers P9 and P10 were used for amplification of nsdAsr. NdeI and XbaI restriction enzyme sites are underlined. Primers P11 and P10 were used for amplification of a 1776-bp DNA fragment containing the coding region of nsdAsr and its 300-bp upstream promoter region.
Media and culture conditions
E. coli strains were cultured using liquid or solid LB medium containing appropriate antibiotics at 37 °C. Antibiotics were used in the following concentrations: apramycin (100 µg/mL), chloramphenicol (25 µg/mL), ampicillin (100 µg/mL), and kanamycin (50 µg/mL). To generate spores, Streptomyces cells were sprayed on MS medium [17] and incubated for 5-6 days at 28°C. Collected spores were washed with water and preserved in water/glycerol (1:1, v/v) at −80°C.
2CMC solid medium [16] was used for conjugation. CP liquid medium [38] was used as seed medium. MS, YMG [39], and Gauze’s No. 1 medium were used for morphological observation. Gauze’s No. 1 medium composes of 20 g of starch, 1 g of KNO3, 0.5 g of KH2PO4, 0.5 g of MgSO4, 0.5 g of NaCl, 0.01 g of FeSO4, and 20 g of agar per liter.
S. rimosus M527 and its derivates were incubated using the method of Zhao et al. [17]. S. diastatochromogenes 1628 and its derivative were incubated using the method of Xu et al. [35]. S. coelicolor M145 and its derivative were incubated using the method of Zhao et al. [38].
Construction of the ΔnsdAsr mutant and its complementation
Plasmid pWHU2653, a delivery vector containing the sgRNA cloning cassette and counterselection marker CodA(sm), was developed for genome editing in Streptomyces using the CRISPR/Cas9 system [34, 40]. sgRNA consists of an exchangeable 20 nt guide sequence that matches the target DNA and an invariant scaffold that binds to Cas9 in pWHU2653. In this study, a protospacer adjacent motif (PAM) for sgRNA and a 20 nt target guide sequence AGGTCGACGCCGGACACGGA of the nsdAsr gene extended by PAM were selected according to the guide design tool (https://zlab.bio/guide-design-resources). To construct the double-enzyme digestion sgRNA cloning cassette, PCR was used to generate the sgRNA with the target sequence using pWHU2653 as the template. Primers P1/P2 were used to amplify the upstream fragment, whereas another pair of primers P3/P4 were used to amplify the downstream fragment. The two fragments, each end flanked by a 20 bp homology sequence from pWHU2653, were spliced together by overlap extension PCR, yielding a 0.3 kb sgRNA fragment in which expression of sgRNA is under control of the constitutive promoter ermE*. The 0.3 kb sgRNA cloning cassette was inserted into pWHU2653 between NheI/XbaI using an infusion cloning kit, generating plasmid pWHU2653-sgRNA. Subsequently, the 2.1 kb upstream homologous arm (UHA) and 2.1 kb downstream homologous arm (DHA) of the nsdAsr start codon were amplified by primer pairs P5/P6 and P7/P8 from genomic DNA of S. rimosus M527, respectively. The resulting DNA fragments, UHA and DHA, were ligated into the HindIII site of pWHU2653-sgRNA using Gibson assembly methods as described by Gibson et al. [41], yielding plasmid pWHU2653-ΔnsdAsr for gene knock out.
The constructed pWHU2653-ΔnsdAsr was introduced into the wild-type strain S. rimosus M527 by intergeneric conjugation as described by Song et al. [16]. Single apramycin-resistant exconjugants were patched on 2CMC agar, containing apramycin and nalidixic acid (300 and 100 µg/mL, respectively), and grown at 28 °C for four or five generations. Genomic DNA was extracted from mycelium grown on the plate and amplified by PCR using primers P9/P10 to verify the deletion of nsdAsr. To obtain plasmid-free progeny, single exconjugants were picked and streaked on 2CMC agar containing 800 μg/mL 5FC and grown in the dark at 28 °C for 3 or 4 days. The 5FCR colonies were then replicated to 2CMC with and without apramycin to confirm plasmid loss. The ΔnsdAsr mutants were named S. rimosus M527-ΔnsdAsr.
For complementation of nsdAsr in S. rimosus M527-ΔnsdAsr, a 1776 bp DNA fragment containing the coding region of nsdAsr and its 300 bp upstream promoter region was amplified by PCR using P11 and P10 as primers. The DNA fragment was inserted into the NdeI and XbaI sites of pSET152 to obtain pSET152::nsdAsr. Introduction of pSET152::nsdAsr and the empty vector pSET152 as a control into mutant M527-ΔnsdAsr by conjugation resulted in the complemented strain S. rimosus M527-ΔnsdAsr/pSET152::nsdAsr and the control strain S. rimosus M527- ΔnsdAsr/pSET152, respectively.
Over-expression/Heterologous expression of nsdAsr in S. rimosus M527/S. coelicolor M145 and S. diastatochromogenes 1628
All recombinant DNA techniques were performed as described by Sambrook and Russell [42]. Plasmid pIB139 [43, 44] is a shuttle vector that replicates in E. coli and integrates site-specifically into Streptomyces chromosomes. Using S. rimosus M527 genomic DNA as a template, a 1476 bp nsdAsr open reading frame (ORF) was amplified by PCR using primers P9 and P10 (Table 1). The PCR product was then digested with NdeI and XbaI and inserted into the corresponding sites of pIB139, yielding plasmid pIB139-nsdAsr. Sequencing of the inserted gene fragment confirmed that the gene did not contain any mutations.
Subsequently, the introduction of the constructed pIB139-nsdAsr into S. rimosus M527, S. coelicolor M145, and S. diastatochromogenes 1628 was conducted by intergeneric conjugation to yield recombinant strains S. rimosus M527-NAsr, S. coelicolor M145-NAsr and S. diastatochromogenes 1628-NAsr, respectively. Recombinant strains were confirmed using apramycin resistance and PCR.
Morphological observation
To evaluate morphological differentiation, wild-type strain S. rimosus M527, the nsdAsr-disrupted mutant M527-ΔnsdAsr, the complemented strain M527-ΔnsdAsr/pSET152::nsdAsr, and the recombinant strain M527-NAsr were streaked on solid MS medium; the wild-type S. diastatochromogenes 1628 and recombinant strain 1628-NAsr were streaked on solid YMG medium; and the wild-type S. coelicolor M145 and recombinant strain M145-NAsr were streaked on Gauze’s No. 1 medium. The morphology of all strains was observed after incubation for 6-7 days at 28°C. Morphological characteristics of the mycelia surface were examined under SEM (JSM-5410LV, JEOL, Tokyo, Japan).
Analysis of gene transcriptional levels by qRT-PCR
Extraction of RNA and analysis of transcriptional levels of rim genes were performed as described previously [17, 36]. Extraction of RNA, design of primers, and analysis of the transcription of toy genes were performed as described by Xu et al. [35]. Extraction of RNA, design of primers, and analysis of transcription of actII-orf4 gene were performed as described by Zhao et al. [38].
Fermentation of antibiotic
Production of rimocidin by S. rimosus M527 was achieved using the method of Zhao et al. [17]. Production of TM by S. diastatochromogenes 1628 was achieved using the method of Ma et al. [36].
Analysis of antibiotic
Rimocidin was analyzed using high-performance liquid chromatography (HPLC) (Varian, USA) method described previously [17]. HPLC analysis of TM used the method of Ma et al. [36]. Gauze’s No. 1 medium was used to identify the production of Act on agar media by directly evaluating the density of the blue color characteristic of this antibiotic.
Statistical analysis
All experiments were performed at least three times, and results were expressed as mean ± standard deviations (SD). Statistical analysis was performed with Student’s t-test.