Isolation, characterization and preparation of hAMSCs
The application of human amnions in this study was approved by the institutional ethics committee of First Affiliated Hospital, Nanjing Medical University. Human placentas were collected from healthy, normal term pregnant woman who underwent cesarean section due to simple hip circumference factors after written and informed consent was signed. Amnion-derived mesenchymal stem cells (hAMSCs) were isolated according to previous reports [31]. Briefly, amniotic membrane was sequentially removed from the placental chorionic layer under aseptic conditions, cleaned to remove the blood cells by DPBS (Gibco, A12856-01) contained Penicillin-Streptomycin (Gibco, 15140), cut into small pieces, immersed in TrypLE (Gibco, 12605-010) at 37°C for 30min with vigorously shaking. The partly digested tissues were transferred into new tubes, washed with DPBS, immersed again in fresh TrypLE at 37°C with vigorously shaking until digested completely. Single cells were collected by centrifuge at 1500rpm for 5min and plated in PLT medium which composed of α-MEM medium (Gibco, 12571-063), 5% UltraGRO-hPL (Helios Bioscience, HPCPLCRL50), 1% L-Glutamine (Gibco, 25030) and 0.03% Heparin Sodium (Changzhou Qianhong Bio-pharma CO.Ltd., H32022088), incubated at 37°C and 5% CO2. Culture cells were trypsinized and passaged when 80–90% confluence observed. The cell line AMSC10 of human amnion mesenchymal stem cells (hAMSCs) was established and its identity, genetic safety, biological safety, toxicology, tumorigenicity, pluripotency, biological activity, and safe dose were completely assessed and all tested items were up to standard (submitted and under review data).
In the study, the fifth-passage hAMSCs were prepared and applied in all of transplantation experiments. Release inspection on the expression of MSCs specific surface markers, concentration of secreting cytokines in cell culture supernatant, cell viability, bacteria contamination and mycoplasma infection cells were carried out before hAMSCs transplantation. MSCs specific surface markers surface markers were detected by flow cytometry. The hAMSCs were harvested, washed, resuspended with PBS Cells were counted and diluted to 2×106 cells/100 ul. Subsequently, cells were incubated with monoclonal phycoerythrin-conjugated antibodies for human CD44 (BD, 555479), CD90 (BD, 555596), CD73 (BD, 550257), CD105 (eBioscience, 2-1057-42), CD11b (BD, 555388), CD19 (BD, 555413), CD34 (BD, 555822), CD45 (BD, 555483) and HLA-DP/DQ/DR (BD, 562008). Appropriate isotype-matched antibodies were used as negative controls. The data from 10,000 viable cells were acquired with a flow cytometer (Beckmen, NAVIOS) and analyzed using the Kaluza software (BECKMAN COULTER: version 1.3). Cell viability were calculated by cell counting using blood cell counting chamber (Reichert Bright-line, Cat.1483), bacteria contamination were assessed by endotoxin detection kit (Zhanjiang Bokang Marine Biological Co., Ltd, China) according to manufacturer's instructions, mycoplasma infection were assessed by real-time fluorescence quantitative polymerase chain reaction with specific primers (Forward primer: GGGAGCAAACAGGATTAGATACCCT and reverse primer: TGCACCATCTGTCACTCTGTTAACCTC) on an Applied Biosystem® CO.Ltd. machine (QuantStudio™ 7 Flex Real-Time PCR System). Qualified hAMSCs were suspended in 1% human serum albumin (HSA), filled in 300ul/tube containing defined number of cells according to different does.
Animals
The application and handle of specific pathogen-free grade C57BL/6 mice was approved by the Animal Ethics Committee of Nanjing Medical University. Eight-week-old male and female and twenty-eight-week-old female C57BL/6 mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. The mice were housed in the SPF-class animal room of Nanjing Medical University. The mice were grouped in 5 mice per cage, were free to eat and drink and were exposed to a day/night discontinuous illumination (12 h:12 h). The food, litter, water and cages used for feeding were strictly disinfected and sterilized.
Establishment of age-related diminished ovarian reserve mouse model
It is reported 32-week-old C57BL/6 mice are equivalent to about 35 years old of human [32], whose fertility have been proved gradually decreasing [33]. Thus the 32-week-old female mice were selected to establish the age-related DOR (AR-DOR) model. The eight-week-old female mice were set as control. Total 200 female mice at 27-week age were purchased and screened firstly by littler size after one time breeding. Then 118 old mice (32-week-old) with 3–8 litters were selected to further analysis. Venous blood sample were collected from control mice and old mice. Levels of anti-Mullerian hormone (AMH), estrogen (E2) and follicle-stimulating hormone (FSH) in serum were accessed. Furthermore, old female mice were humanely sacrificed and follicles at different development stages in ovaries were count and analyzed. The old female mice had significantly less litter size, lower levels of AMH and E2 in serum, lower numbers of secondary and antral follicles, indicating the AR-DOR model was successfully established (Fig. 2).
hAMSCs transplantation and mice treatment on endpoints
The safe dose of hAMSCs via tail vein injection in mouse is below 5.0×107cells/kg body weight according to our exploration (submitted and under review data). The AR-DOR model mice were randomly assigned into 5 groups (22 mice/group): the normal saline group (NS), the 1% human serum albumin group (HSA), the low-dose group (LD, 5.0×106cells/kg), the medium-dose group (MD, 7.5×106cells/kg), the high-douse group (HD, 1.0×107cells/kg). Each mouse was slowly injected with 300ul of the corresponding preparation through the tail intravenous for total 3 times at a 4 days interval. 7 days after the last injection, 8 mice from each group were collected venous blood to perform hormone assay, and then humanely sacrificed to carried out follicles and oocyte counting, 2-cell and blastocyst formation, apoptosis analysis, histology and, immunofluorescence assay, and 6 mice from each group were humanely sacrificed to collect ovary to perform western blot assay. About 2 weeks after the last injection, the left mice from each group were humanely sacrificed to perform analysis on gestation rate and number of live fetus.
Enzyme-linked immunosorbent assay (ELISA)
Blood was taken from the eye posterior orbital venous plexus of the mice (36-week-old) on the day 7 of the last hAMSCs transplantation. Serum was collected following centrifugation at 3000 rpm for 15 min and stored at − 80°C before hormone analysis. The levels of E2, FSH and AMH were measured according to the manufacturer’s guide of ELISA kit (Jining Shiye, A05182, A05021, N04308) on a Full-wavelength microplate reader (Thermo scientific, Multiskan GO).
HAMSCs culture supernatant was collected and stored at -80°C for analysis. The secreting cytokines level of interleukin-6 (IL-6), fibroblast growth factor 7 (FGF7) and angiopoietin-1 (ANG-1) were measured according to the manufacturer’s guide of ELISA kit (Multi Sciences, 70-EK106/2, 70-EK1262, 70-EK1122) on a Full-wavelength microplate reader (Thermo scientific, Multiskan GO).
Oocyte counting, in vitrofertilization and embryo culture
Oocytes from each group (8 mice/group) were harvested, counted and then performed in vitro fertilization and in vitro embryo culture to evaluated the effects of hAMSCs transplantation on the egg quality. A sperm suspension was prepared at least 1 h before fertilization. In brief, 10-weeks-old C57BL/6 males were sacrificed by cervical dislocation. Epididymis was dissected and cut by a single-use needle. Spermatozoa were overflowed into a drop of Human Tubal Fluid (HTF: EasyCheck, M1130) medium covered with mineral oil (Sigma, M8410) and incubated at 37°C for 60 min (for capacitation). Then the female mice which injected different preparation were humanely sacrificed by cervical dislocation. Oviducts were dissected and cut open the fallopian tube where the enlarged and bright ampulla was picked by a single-use needle and transferred in M2 media (Sigma, M7167). In vivo-matured oocytes (within cumulus follicular complex, COCs) were incubated with spermatozoa for 5h. Zygotes were washed and cultured in KSOM (EasyCheck, M1430) embryo culture medium under mineral oil in groups of 15–20 embryos per drop (30uL). The number of zygotes after fertilization was recorded as the number of eggs obtained in mice. Embryos were cultured at 37°C with 5% CO2. the proportion reaching the 2-cell (24–30 h after fertilization) and blastocyst (96–100 h after fertilization) stages were recorded.
Ovarian morphology analysis and follicle counting
Ovaries from each group (8 mice/group, 36-week-old) were collected at a week after the last hAMSCs transplantation, fixed in 4% paraformaldehyde at room temperature overnight, then dehydrated, embedded in paraffin, sliced into 5µm serial sections, stained with hematoxylin and eosin (H&E) according to standard protocol. The follicles containing oocytes with a visible nucleus were counted in every fifth section of the entire ovary and were scored as primordial, primary, secondary, or antral follicles based on their morphological appearances as described previously [34]. Briefly, primordial follicles were classified as an oocyte surrounded by one layer of flattened granulosa cells, primary follicles were classified as an oocyte surrounded by one layer of cuboidal granulosa cells, secondary follicles were classified as an oocyte surrounded by more than one layer of cuboidal granulosa cells with no visible antrum, and antral follicle were classified as an oocyte surrounded by multiple layers of cuboidal granulosa cells and containing one or more antral spaces.
Gestation rate and live fetus number assay
The female and male mice were combined in a 2:1 cage for 2 weeks beginning from the day7 of the last injection, and the semen plug picked up was marked as E0.5. The female mice were injected with 0.4% trypan blue solution (Gibco, 15250061) into the tail vein in E5.5, and the uterus was removed by abdominal surgery. The number of blue bands around uterine horns were counted [35] and gestation rate was calculated by formula: number of pregnant females/number of inseminated females [36].
Apoptosis assay
A TUNEL apoptosis assay kit was used to detect ovarian cell apoptosis in each group at a week after the last hAMSCs transplantation according to the manufacturer’s instructions (Beyotime, C1098). Nuclei of apoptotic cells were stained dark brown. Sections were observed and imaged using an optical microscope. The apoptotic cells on sections were counted using a double-blind method and analyzed by two technicians.
Histology and immunofluorescence
Immunofluorescence experiments were carried out to trace hAMSCs homing, differentiation and evaluated the expression level of phosphorylated FoxO3a in ovary after cell transplantation. Paraffin-embedded sections of ovaries were dewaxed, and heat-mediated antigen retrieval was performed by microwaving for 20 min in 10 mM sodium citrate (pH 6.0) (Beyotime, P0083). The sections were cooled for 15 min, washed in deionized water, rinsed in PBS, incubated in 5% goat serum for 60 min, then incubated overnight at 4°C with primary antibodies of anti-human STEM121 antibody (1:100, TAKARA, Y40410), mouse anti-human CD73 antibody (1:100, Abcam, ab133582) and rabbit anti-FoxO3a antibody (1:100, CST, 12829) followed by incubation with secondary antibodies of CoraLite488 conjugated Goat Anti-mouse IgG (H + L)(1:100, Invitrogen, A21202) and Goat anti-rabbit IgG (H + L)(1:100, Abcam, ab150078) for 1 h at room temperature. DAPI (Beyotime, C1006) was used for DNA counter staining. The signals were acquired by performing the same immunostaining procedure and setting up the same parameters with a confocal microscope (Nikon, ECLIPSE Ti).
Western blot
The ovaries from NS, HSA and hAMSCs groups were pooled separately in SDS-PAGE protein loading buffer (Beyotime, P0015) and RIPA Lysis and Extraction Buffer (ThermoFisher, 89900) with protease and phosphatase inhibitor Cocktail (ThermoFisher, 78443). Then samples were denatured at 95°C for 10 min and stored at -80°C. After thawing, loaded on a 10% SDS-PAGE, blotted on polyvinyl fluoride (PVDF) membranes (Biorad, 1620177). Non-specific binding sites were blocked for 1h at 37°C with 5% no-fat dry milk (BD, 2321000) in Tris-buffered saline containing 0.05% Tween 20 (TBS-T). Membranes were incubated with polyclonal rabbit anti-Sod1 (1:1000, Abcam, ab13498), rabbit anti-FoxO3a (1:1000, CST, 12829), rabbit anti-p-FoxO3a (1:1000, CST, 9466), rabbit anti-Ampk (1:1000, Abcam, ab133448) and rabbit anti-GAPDH (1:5000, Proteintech, 10494-1-AP) overnight at 4°C, followed by incubation with horseradish peroxidase (HRP) conjugated anti-rabbit secondary antibody (1:1000, Abcam,ab6721) for 1h at room temperature. After washing, specific immunoreactive complexes were detected by ECL kit (ThermoFisher, 32209). The bands were normalized for Gapdh using ImageJ software (NIH, Bethesda, MD, USA) and values were given as relative units. The experiment was performed in triplicate.
Statistical analysis
Each experiment was performed at least three times. All data were analyzed with SPSS20 software and are presented as mean ± SEM. One factor t-test was used to determine significant differences among the groups. In all statistical comparisons, P < 0.05 was taken to indicate a statistically significant difference.