Study site and mosquito collection: Mosquitoes were collected using Centers for Disease Control (CDC) light (not baited with carbon dioxide), BG-Sentinel lure, and gravid traps between June 24 and October 4, 2021 in Wooster (Figure 1). Four traps of each type were used in this study. Traps were placed outside of residential houses in Wooster between 6 PM and 8 PM and were checked between 8 AM and 10 AM the following morning. Mosquitoes were collected daily on weekdays (except on holidays) at 10 different sites (Figure 1) distributed across Wooster. Each site had one trap and two extra-traps were individually rotated between sites (leading to the temporary presence of two traps at one site during the first months) to obtain the same night trap effort between sites. Two sites were characterized by the presence of a forest and a stream, and eight by a lake or a stream. No mosquito control actions were implemented at the selected sites. Collected mosquitoes were brought by car to The College of Wooster for identification. Wooster is located in Northeastern Ohio and has educational and research facilities such as the College of Wooster and a campus of the Ohio State University. A map of Wooster was created using the packages ggmap version 3.0.0.903, ggspatial 1.1.5 and ggsn 0.5.0 in R 4.2.0 (18). Soils in Wooster are not well drained with rocky side slopes and they have few organic deposits. Most rainfalls are between April and September and relative humidity is around 60%. In winter and summer, the mean temperatures are -3°C and 21°C, respectively. The mosquito season starts in June and lasts until October, with peak activity in summer (June to August).
Mosquito identification: Collected mosquitoes were morphologically identified using the key of Harrison et al. (2016) and the Walter Reed Biosystematics Unit’s website (19,20). The morphological identification was confirmed by the Ohio Department of Health. DNA isolation, polymerase chain reaction (PCR) and Sanger sequencing were used for molecular confirmation of the identification of only Ae. japonicus using six individual mosquitoes randomly chosen among collection sites and months.
DNA isolation: DNAzol (Invitrogen, USA) was used for isolation of DNA. Individual mosquitoes were ground and homogenized in 100μL DNAzol and centrifuged at 11,000 g for 10 minutes at 15°C. The supernatant was pipetted into a new 2mL tube followed by precipitation with 0.5 volume absolute ethanol. Tubes were gently mixed for 1 min and then centrifuged at 11,000g for 10 min at 15°C. The formed DNA pellet then underwent two washes with 1mL 75% ethanol, followed by another centrifugation (Eppendorf Centrifuge 5418R, Eppendorf, Germany) at 11,000 g for 10 min at 15°C. Samples underwent a final 11,000g centrifugation for 1 min at 15°C before drying at room temperature for 15 min. DNA was re-suspended in 100μL of nuclease-free water.
PCR, electrophoresis, and Sanger sequencing: Folmer’s protocol was used to amplify a region of cytochrome oxidase subunit 1 (COI) gene via polymerase chain reaction (PCR) (21). A total volume of 25µL of the PCR mix contained 12.5µL GoTaq® Colorless Master mix (1X, Promega, USA), 0.5µL of each primer (0.2µM, LCO1490: 5’ – GGTCAACAAATCATAAAGATATTGG – 3’, HC02198: 5’ – TAAACTTCAGGGTGACCAAAAAATCA – 3’), 1µL of DNA (250 ng-1µg), and 10.5µL of free nuclease water. The PCR cycle consisted of 3 min of initial denaturation at 95°C, followed by 40 cycles of 30 seconds of denaturation at 95°C, 30 sec of annealing at 60°C and 30 sec of extension at 72°C. The final extension was at 72°C for 3 min. The PCR product was separated on 2% agarose gel stained with Gelred (Biotium, USA) and visualized under a ChemiDoc MP imaging system (Biorad, USA). Before Sanger sequencing, PCR product was purified by using an ExoSAP treatment (Thermo Fisher, USA) following the manufacturer's instructions. Sanger sequencing of the DNA was performed at the Molecular and Cellular Imaging Center (MCIC), Ohio State University, Wooster, Ohio, USA.
Phylogenetic analyses: Sequences were visualized and manually edited using SnapGene Viewer 5.2.4. The basic local alignment search tool (BLAST) was used to find sequences similar to ours in the NCBI nucleotide database (GenBank). We combined our sequences with sequences from the most similar BLAST hits as well as Ae. japonicus sequences from sites in US states close to Ohio in a single FASTA file. The sequences were aligned using MAFFT 7.49 with settings “--reorder --auto --adjustdirection –leavegappyregion”, and a tree was inferred using IQ-Tree 2.2.0 with the default model selection that uses ModelFinder and with 1,000 ultrafast bootstraps (22–24). The resulting tree was visualized with the R/Bioconductor package ggtree 3.3.2 in R 4.2.0 (25).