Human samples collection and preparation
Malaria patients with P. falciparum or P. vivax were confirmed by microscopic examination by medical laboratory scientists at Buntharik district hospital in Ubon Rachathani. (Ethics approval by Ethics committee of the Faculty of Tropical Medicine, Mahidol University, MUTM 2012-046-05). Parasite species were identified and parasitaemia of each sample was calculated by counting the number of malaria-infected erythrocytes over the number of normal erythrocytes per thousand cells. Uninfected donors were recruited, and venipuncture was performed for all donors using tri-potassium ethylenediaminetetraacetic acid (K3EDTA) as an anticoagulant. K3EDTA blood samples were then centrifuged at 1,500 x g for 15 minutes.
Then, platelet-free plasma samples were prepared by centrifugation at 13,000 x g for 2 minutes at room temperature (RT) [17]. Supernatants were collected and stored at -80oC for further isolation of EVs. Samples were then shipped to the University of Technology Sydney where all experiments were performed.
Extracellular vesicles isolation from human plasma
500 µL of supernatants were mixed with 200 µL of sodium citrate and 300 µL of phosphate buffered saline (PBS) and then centrifuged at 150,000 x g for 3 hours at 15oC. Supernatants were discarded and pellets were resuspended in 100 µL sodium citrate and 900 µL PBS and subjected to centrifugation at 150,000 x g for 3 hours at 15oC.
Total RNA extraction
Pellets obtained after centrifugation were homogenized with 1 mL of RNAzol (Molecular Research Center, Inc) and 400 µL of UltraPure™ DNase/RNase-Free distilled water (Invitrogen ™). After a five-minute incubation at RT, they were centrifuged for 15 minutes at 12,000 x g at 4oC. Supernatants were transferred to new tubes with 800 µL isopropanol and 5 µL glycogen (5 mg/ml) then gently mixed. They were then placed at -30oC overnight and spun for 10 minutes at 12,000 x g at 4oC the next day. Pellets were kept and washed with cold 75% ethanol to remove excess isopropanol, spun at 9,000 x g for 3 minutes at 4°C, the supernatant was discarded, and these steps were repeated twice. Later, excess ethanol was removed by spinning at 12,000 x g for 30 seconds. RNA pellets were resolubilized with 10 µL of UltraPure™ DNase/RNase-Free distilled water and heated for 5 minutes at 55°C. Lastly, they were vortexed and briefly spun down.
Total RNA concentration measurement and cleaning
RNA concentration was measured using the NanoDrop One Microvolume UV-Vis Spectrophotometer (Thermo Scientific™). If the quality of total RNA in the samples was not optimal, i.e., the Nanodrop flagged the result as phenol contamination or Absorbance 260/230 < 1.7, a sodium acetate (NaOAc), a cleaning step was performed. Briefly, 5 µL of glycogen (5mg/ml) and 2.5 µL of sodium acetate (3M pH5.5) were added to samples and mixed comprehensively. The mixture was supplemented with 110 µL of absolute ethanol and incubated overnight in -30 oC. Later, washing steps were performed as mentioned in the RNA extraction with RNAzol above.
Primers for miRNAs detection
All primers in this study was purchased from Thermo Fisher Scientific.
Five human miRNAs were used to perform quantitative polymerase chain reaction as described in Table 1.
Table 1: Primers used for quantitative PCR
miRNAs
|
NCBI Accession Number
|
Mature miRNAs Sequences
|
hsa-miR-451a
|
MI0001729
|
AAACCGUUACCAUUACUGAGUU
|
hsa-miR-15b-5p
|
MI0000438
|
UAGCAGCACAUCAUGGUUUACA
|
hsa-miR-16-5p
|
MI0000070
|
UAGCAGCACGUAAAUAUUGGCG
|
hsa-let-7a-5p
|
MI0000060
|
UGAGGUAGUAGGUUGUAUAGUU
|
hsa-miR-150-5p
|
MI0000479
|
UCUCCCAACCCUUGUACCAGUG
|
Reverse transcriptase quantitative polymerase chain reaction (RT-qPCR)
As the NanoDrop was not sensitive enough to measure the RNA concentration, fixed volumes of RNA for cDNA synthesis were used. To analyse miRNAs expression, 0.5 µL of total RNA was used for cDNA synthesis. RT-qPCR was performed as per manufacturer protocol using TaqMan® fast advanced master mix and TaqMan® advanced miRNA assay. Quantitative PCR (qPCR) was run on the QuantStudio 6 flex system (Applied Biosystem) in triplicate together with distilled water as negative control.
Relative Expression analysis
Only samples that had not been already freeze-thawed were included in the study to avoid RNA degradation. Comparative threshold cycle or quantification cycle Cq (as described in [49]) method was used to analyse the qPCR data. Each sample was run in triplicates. Then, the average Cq from the three Cq values of those samples was calculated. To select one miRNA as an endogenous control, mean, standard deviation and variance for each miRNA analysed were calculated. ΔCq was then calculated using the following equation ΔCq = Cq of miRNA – Cq of endogenous control and relative expression was calculated by 2(- ΔΔCq) [50].
Target prediction and pathway involvement of dysregulated miRNAs
To predict possible targets of up-regulated miRNAs, the miRNAs of interest was submitted to Targetscan Release 7.2 and the predicted target genes were retrieved [51]. Then, the targets that overlapped genes involved in malaria pathway were obtained from the Kyoto Encyclopedia of Genes and Genomes (KEGG) [52]. In order to identify the pathways for individual and combined analysis of miRNAs, DIANA-mirPath v3.0 was used, with a 5% false discovery rate (FDR) [53]. Fisher’s exact test (Hypergeometric distribution) was applied for enrichment analysis. The potential pathways were considered based on their p-value (p < 0.05).
Evaluation of potential EVs-derived miRNA as biomarker
Mean of Delta Cq for each miRNA was used in this analysis following the previous study [54]. The receiver operating characteristic (ROC) was calculated to propose the potential use of miRNAs as diagnostic tools. Area under the curve (AUC) was analysed to show the accuracy of the test with p-value of each analysis.
Statistical analysis
For the samples, demographic, mean age of each group was presented by average and standard deviation. All data was tested for their normality by using Kolmogorov-Smirnov or Shapiro-Wilk tests and a non-parametric statistical analysis method was chosen. Comparison of parasitaemia percentage was achieved by the Mann-Whitney U Test. Kruskal-Wallis test was used for comparison of relative expression of miRNAs in each biological group followed by post-hoc analysis using Dunn’s test. Statistical significance for all tests was considered significant for α = 0.05. All statistical tests were analysed by Prism 8. All figures shown in this article were created by Prism 8 software for Mac, GraphPad Software, La Jolla California USA, www.graphpad.com.