Human EPO mRNA-transfected KMSC generation and MP isolation
KMSCs isolated from an FVB male mouse kidney were cultured on gelatin-coated dishes in α-minimum essential medium (MEM) with 10% horse serum (Gem Biotech, Woodland, CA, USA) to 80% confluence, as previously described [31]. These KMSCs were transfected with the human EPO gene and used to generate MPs. Briefly, HEK293T cells, used as packaging cells, were transfected with a lentiviral expression vector containing EPO, copGFP and packaging construct to generate lentiviral supernatants [32]. Meanwhile, empty control vectors were used to generate MOCK-KMSCs. After the KMSC cells had been transduced, hEPO-KMSCs were identified by cop green fluorescent protein (GFP) expression using fluorescence microscopy and EPO mRNA reverse transcription polymerase chain reaction (RT-PCR). The hEPO-KMSCs were then cultured on gelatin-coated dishes in MEM with 10 % horse serum (Gem Biotech, Woodland, CA, USA), as described previously [31]. EPO secretion was measured in the supernatant of the hEPO-KMSCs by an enzyme-linked immunosorbent assay (ELISA) specific for human EPO (Quantikine, R&D Systems, Minneapolis, IL, USA).
To isolate hEPO-MPs, hEPO-KMSCs were cultured in serum-free α-MEM (Gibco, Carlsbad, CA, USA) and 1 % O2 in a controlled atmosphere chamber using an O2 analyzer (Thermo Scientific, Marietta, OH, USA) for 24 h. Cell debris was removed by centrifugation at 2,000 ´g for 10 min at room temperature and the cell-free supernatants were centrifuged at 50,000 ´g (Beckman Coulter Optima L-90 K Ultracentrifuge, CA, USA) for 2 h at 4 °C before being washed in phosphate-buffered saline (PBS) and centrifuged again under the same conditions. MOCK-MPs were isolated from the MOCK-KMSCs using the same protocol. hEPO-MP and MOCK-MP pellets were suspended in culture medium for the MDCK cell experiments and labeled with CellTracker™ (Invitrogen, Carlsbad, CA, USA) to allow them to be traced during in vivo and in vitro functional experiments.
Characterization of isolated MPs
To analyze the characteristics of the isolated MPs, MP-containing pellets were resuspended in sterile 1´ PBS or 1´ Annexin V Binding Buffer (BD Biosciences, San Diego, CA, USA) consisting of 0.1 M HEPES/NaOH (pH 7.4), 1.4 M NaCl, and 25 mM CaCl2, and diluted 1:10 with distilled water for 1 h at 4 ℃. Samples were kept on ice in the dark until flow cytometric analysis was performed using the following PE-conjugated antibodies: CD29, CD44, and CD73 (Biolegend, San Diego, CA, USA), as described previously with the BD FACS Canto Ⅱ (BD Biosciences, San Jose, CA, USA). PE-conjugated isotype-matched antibodies were used as a negative control. Different sized beads (0.1, 0.2, 0.5, 1 μm, Invitrogen, Carlsbad, CA, USA) were used as size markers while a log scale was used to analyze forward (FSC) scatter and side (SSC) light scatter parameters. Spectral overlap compensation between fluorochrome channels was carried out for each experiment using single-color-stained MP populations. For each experimental sample, a corresponding isotype control or positive/negative MP populations were used to set gates. All data were analyzed using FlowJo software (TreeStar Inc, Ashland, OR, USA). Size distribution of the MPs was determined using nanoparticle tracking analysis (NanoSight NS300, Malvern Instruments, Malvern, UK).
MDCK cell culture and treatment with rhEPO or MPs
To assess the effects of rhEPO and MPs in vitro, we used MDCK cells purchased from the Korean Cell Line Bank (Seoul, South Korea). The cells were seeded into six-well culture plates (5 ´ 104 cells/well) with complete Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10 % fetal bovine serum (FBS; Gibco, Carlsbad, CA, USA), penicillin G (100 U/mL), and streptomycin (100 U/mL), and cultured at 37 ℃ in 5 % CO2 for 48 h. The cells were incubated in serum-free medium for 24 h and transferred into DMEM with 1 % FBS (vehicle) or stimulated with recombinant human TGF-β1 (5 ng/mL, PeproTech, Rocky Hill, NJ, USA cat no. 100-21) for 48 h. The medium was changed and the cells were treated with TGF-β1 (5 ng/mL), MOCK-MPs (4 μg/mL), hEPO-MPs (4 μg/mL), or rhEPO (100 IU/mL) for a further 48 h. Incorporation of red fluorescent CellTracker™-labeled MPs into the cell cytoplasm was detected using a fluorescence microscope, and changes in MDCK cell morphology were assessed.
Immunocytochemical staining of EMT markers
Treated MDCK cells were washed twice with PBS (pH 7.4), immediately fixed with 4 % formaldehyde diluted in PBS for 15 min at room temperature, and permeabilized with 0.2 % Triton X-100 for 10 min. The cells were then blocked with 1 % bovine serum albumin for 30 min at room temperature, incubated overnight at 4 ℃ with the corresponding antibodies, and rhodamine-conjugated antibodies against rabbit IgG were used to detect the primary antibodies. Samples were stained with 4,6-diamidino-2 -phenylindole (DAPI) and mounted using a Slow Fade Light Antifade kit with DAPI (Molecular Probes, Eugene, Oregon, USA). Immunostained cells were visualized using an LSM-780 META confocal microscope (Carl Zeiss, Oberkochen, Germany) at a wavelength of 405 nm for DAPI, 488 nm for GFP, and 647 nm for rhodamine. Fluorescence intensity was assessed by examining at least five fields per section under ´400 magnification by MetaMorph digital image analysis (BioVision, Exton, PA, USA).
Immunoblotting of EMT markers and Smad/non-Smad proteins in MDCK cells
For western blotting, MDCK cells were lysed in 300 μL of cell lysis buffer containing 150 mM NaCl, 1 % IGEPALâ CA-630, 0.5 % sodium deoxycholate, 0.1 % sodium dodecyl sulfate (SDS), 50 mM Tris (pH 8.0), and a protease inhibitor cocktail (Thermo Fisher Scientific, Waltham, MA, USA). Whole cell lysates were resolved by sodium dodecyl sulfate-polyacrylamide (SDS-PAGE) gel electrophoresis and transferred onto polyvinylidene fluoride membranes (Millipore, Billerica, MA, USA). After blocking with 5 % skim milk, the membranes were incubated with primary antibodies against E-cadherin (1:500; BD Biosciences, Bedford, UK), α-SMA (1:10000; R&D, Minneapolis, IL, USA), fibronectin (1:1000; Santa Cruz, CA, USA), phospho-p38 (1:1000; Santa Cruz), p38 (1:1000; Abcam, Cambridge, UK), phospho-Smad2 (1:500; Millipore), Smad2 (1:1000; Santa Cruz), phospho-Smad3 (1:500; Abcam), Smad3 (1:1000; Cell Signaling Technology, Danvers, MA, USA) and GAPDH (1:1000; Cell Signaling Technology, Danvers, MA, USA). The membranes were then washed three times in 1´ PBS with Tween-20 (VWR Amresco, Solon, Ohio, USA) for 5 min and incubated with horseradish peroxidase-conjugated secondary antibodies. Target proteins were visualized using Amersham ECL Western Blotting Detection Reagent (GE Healthcare Life Sciences). Band densities were measured using NIH Image J software.
Quantitative real-time polymerase chain reaction (qRT-PCR) of MDCK cells
Total RNA was isolated from MDCK cells using an RNeasy Mini Kit (QIAGEN, Germantown, MD, USA) and cDNA was synthesized using a DNA Synthesis Kit (QIAGEN). qRT-PCR was performed using an ABI StepOnePlus real-time PCR system (Applied Biosystems, Beverly, MA, USA) with double-stranded DNA synthesis monitored using SYBR Green (Applied Biosystems). Triplicate test reactions were carried out for each sample to analyze gene expression, which was normalized to β-actin mRNA expression. Negative cDNA controls were cycled in parallel with each run. The primer sequences are listed in Table 1.
Table 1. qRT-PCR primers
Gene
|
Forward primers (5′ to 3′)
|
Reverse primers (5′ to 3′)
|
Canine E-cadherin
|
CTGTCACTGTGGACGTGGAA
|
CTTGCGCCGTGTGTTAGTTCC
|
Canine vimentin
|
AACCGGAACAATGATGCCCT
|
CATTTCACGCATCTGGCGTT
|
Canine α-SMA
|
ATGCAGAAGGAGATCACCGC
|
CACAGAGCAAGGAAGCGTCT
|
β-actin
|
CGCAATGAAGTGGAGTCTGA
|
ATAGCAGCAGACAGAGGCAAC
|
Animal experiments
Adult FVB/N mice (five to seven weeks old) were purchased from Koatech (Gyeonggi-Do, Korea). Animal study protocols were designed in accordance with guidelines for the use of laboratory animals and were approved by the Institutional Animal Care and Use Committee (IACUC) of Yonsei University Healthcare System. The animals were maintained under temperature-controlled conditions with a 12-h light/dark cycle and were provided with water and food ad libitum. UUO was performed using an established protocol [24]. Briefly, FVB mice were anesthetized with isoflurane plus oxygen and placed on a heating pad (Jeung Do Bio & Plant Co, Seoul, Korea) to maintain their temperature at 37 ℃. The left ureter was exposed using a flank incision and ligated with 3-0 silk at two points just below the lower pole of the left kidney, and then, the peritoneal membrane and skin were sutured. Sham animals underwent the same procedure, except that the ureter was not ligated. Following surgery, the mice were randomly divided into four groups and administered the vehicle (150 μL saline) only, MOCK-MPs (80 μg/150 μL), or hEPO-MPs (80 μg/150 μL) via the tail vein (n = 5 per group). In the rhEPO-treated group, rhEPO (1000 U/kg) was administered intraperitoneally every other day. Our previous study showed that seven days of UUO could induce significant TIF in FVB/N mice [24]. Therefore, all mice were sacrificed seven days after UUO surgery, and the unilaterally obstructed kidney was harvested for tissue collection. Half of the kidney tissue was fixed in 4 % paraformaldehyde (PFA) for subsequent histology and immunofluorescence, while the remaining half was flash frozen for protein and mRNA isolation.
Immunohistochemical and immunofluorescence analysis
To analyze kidney fibrosis, kidney sections were stained with Sirius red, Masson’s trichrome, and anti-α-SMA (Sigma) and examined by light microscopy. Positive Sirius red, Masson’s trichrome, and anti-α-SMA (Sigma) staining areas were evaluated relative to the unit area and expressed as a percentage per unit area using MetaMorph microscopy image analysis software (Molecular Devices, Sunnyvale, CA, USA). Macrophage immunohistochemistry was performed using anti-F4/80 (Abcam) antibodies and F4/80-positive cells quantified as the number of cells per high power field [24]. Microscopy assessment was carried out in a blinded manner, with 20 randomly selected fields from each slide section examined at ×400 magnification. To trace MPs in vivo, freshly isolated MPs were labeled with red fluorescent CellTracker™ and detected within the peritubular interstitium of kidney sections by immunofluorescence microscopy.
Immunoblotting of renal fibrosis markers
For western blotting, mouse kidney tissues were lysed in 300 μL of cell lysis buffer containing 150 mM NaCl, 1 % IGEPALâ CA-630, 0.5 % sodium deoxycholate, 0.1 % sodium dodecyl sulfate (SDS), 50 mM Tris (pH 8.0), and a protease inhibitor cocktail (Thermo Fisher Scientific). Kidney tissue lysates were resolved by sodium dodecyl sulfate-polyacrylamide (SDS-PAGE) gel electrophoresis and transferred onto polyvinylidene fluoride membranes (Millipore), blocked with 5 % skim milk, and incubated with primary antibodies against E-cadherin (1:1000; Santa Cruz), collagen Ⅰ (1:500; Santa Cruz), α-SMA (1:10000; R&D), fibronectin (1:1000; Santa Cruz), TGF-β1 (1:1000; Santa Cruz), and GAPDH (1:1000; Cell Signaling Technology). The membranes were then washed three times with 1´ PBS with Tween-20 (AMRESCOâ) for 5 min, incubated with horseradish peroxidase-conjugated secondary antibodies, and washed again using the same procedure. Target proteins were visualized using Amersham ECL Western Blotting Detection Reagent (GE Healthcare Life Sciences), and band density was measured using NIH Image J software.
Statistical analysis
Data were expressed as the mean ± standard deviation and were statistically analyzed using SPSS 18.0 software (SPSS Inc., Chicago, Ill, USA). Between-group comparisons were made by one-way analysis of variance (ANOVA) followed by the Student-Newman-Keuls test. Multiple tests were applied only when a significant difference was determined by ANOVA. P values of < 0.05 were considered statistically significant. All experiments were repeated at least three times with similar results.