Primary cell isolation and cell culture
Isolation of ADSCs was carried out according to the previously published reference [36], allogeneic ADSCs were isolated from the inguinal fat pad (about 1.5cm3) of male adult Sprague-Dawley rat aged 12–16 weeks. In brief, the fat pad was washed with cool sterilized phosphate-buffered saline (PBS) three times, minced with sterile scissors, and digested with 0.1% type I collagenase (Gibco; 17100-017) at 37°C for 1.5 h, during which time the tube was shaken every few minutes. The cell suspension was centrifuged at 300 g for 3 min. Then, the supernatant was discarded, and the pelleted stromal vascular fraction (SVF) containing ADSCs was resuspended in complete medium and filtered through a 70µm mesh filter. The cell suspension was centrifuged again, and the cell pellet were seeded at 6×104 cells cm2 in T-25 flasks (Coring) in basal medium DMEM/F12 medium (Gibco) supplemented with 10% FBS (Gibco), 100 IU penicillin and 100 mg/ml streptomycin (1% P/S; Gibco) and incubated at 37°C with 5% CO2 and humidified incubator. The medium was carefully changed after 24 h. The culture medium was changed every 3 days after that, until the cells reached a confluence of 80–90%. The cells were enzymatically dissociated with 0.25% trypsin-EDTA for subculture.
As for isolation of primary articular chondrocytes, cartilage specimens of new-born Sprague-Dawly (SD) rats were washed in sterile PBS contained penicillin-streptomycin and then diced. Subsequently, cartilage were isolated by digesting the matrix overnight in high-glucose DMEM (Gibco, USA) supplemented with 0.2% type II collagenase (Gibco; 17101-015) and 1% P/S. The cell suspension was filtered by a 70µm cell strainer; and the collected cells were centrifuged at 400 g for 5 min, and then the pellets (primary chondrocytes) were resuspended in high-glucose DMEM supplemented with 10% FBS and 1% P/S. The medium was replaced every other day. Cells were used at passage 3. C28/I2 cells, the normal human chondrocytes, were cultured in DMEM (Gibco, USA) supplemented with 1% P/S and 10% FBS (Gibco, USA) in an atmosphere containing 5% CO2 at a temperature of 37°C.
Experimental OA model
Six-week-old Male SD rats were purchased from SLAC Laboratory Animal Co. Ltd. (Shanghai, China). All rats were maintained on a 12-h light cycle in the animal facility of the Animal Unit of Tongji University. When the rats were eight week old, they were subjected to destabilization of the medial meniscus (DMM) and anterior cruciate ligament transection (ACLT) surgery to induce OA, as previously described [37, 38]. Specifically, the DMM + ACLT surgery was performed by surgical sectioning of the medial meniscotibial ligament and the sham operation was performed by incision of the cutaneous and muscular planes at baseline.
In the animal section (Fig. 1A), all rats underwent DMM + ACLT surgery or sham surgery were randomly divided into three groups: (1) sham group; (2) PBS group; (3) PBS-ADSCs group. Three weeks after operation, rats were given multiple intra-articular injections of 100 µl PBS or 100 µl ADSCs (2×106cells, P2-P3) during the following 6 weeks (once a week). All animal procedures were reviewed and approved by Ethical Committee of Laboratory Animals Research Center, Tongji University. The approval number was TJAA07622701. After 9 weeks of operation, the rats were killed and the joint samples were subjected to pathological analysis.
The tissues preparation
The trial rats were killed and total knee joints were fixed with 4% paraformaldehyde for 24 h, decalcified with 0.5 M EDTA at pH 7.4 for 40 days and subsequently embedded in paraffin. 5-µm-thick sections were cut for Safranin O/Fast Green staining. Cartilage degeneration was graded in Safranin-O/Fast Green-stained sections using the Osteoarthritis Research Society International (OARSI)-modified Mankin criteria [39]. Each section was assessed by two blinded, independent graders and the average score was used for statistical analysis.
After decalcification, the tissues were rinsed with 1×PBS three times for 5min, then immersed in 30% sucrose for 12-16h at 4°C until the tissues sinks. Transfer the tissues to a cryomold containing OCT (Sakura, 4583), and then store at -80°C. 5-µm-thick sections were cut with freezing microtome (Leica, CM1950) for tissue immunofluorescence.
The samples were rinsed three times in cool PBS for 5min each, then were blocked in Blocking Buffer [1X PBS (BI, 02-024-1ACS) /5% normal serum (Jackson lab, 005-000-121) /0.3% Triton™X-100 (Sangon Biotech, A110694)] for 60 min at room temperature. Samples were incubated with the indicated antibodies overnight at 4°C, and rinsed three times in PBS for 5min each. Then Samples were incubated with corresponding fluorochrome-conjugated secondary antibody diluted in antibody dilution buffer for 1h protected from light, and rinsed three times in PBS for 5min each. The samples were stained with DAPI (Sigma, 32670), and then rinsed three times in PBS for 5min each. Representative images were photographed using a laser scanning confocal microscope (Leica, TSC SP8). The primary antibodies used were mouse anti-COL2A1 (Invitrogen, MA5-12789), mouse anti-MMP13 (Invitrogen, MA5-14238). For secondary reactions, Alexa Fluor 488 goat anti-mouse IgG secondary antibody (Invitrogen, A32723) was used.
Plasmids
The complete open reading frame (ORF) of the rat ATG4A gene was purchased from Sangon Biotech (Shanghai, China) Co., Ltd, including the ATG4A cDNA (1221bp) flanked by multiple cloning sites and preceded by a Kozak consensus sequence for optimal translation initiation. Then the ORF of the rat ATG4A gene was inserting into pLVX-IRES-Zsgreen (Takara, 632187) followed by site-directed mutagenesis (NEB) to remove the secondary tag. The sequences was confirmed by DNA sequencing analysis.
Cell treatment and transfection
The rat chondrocytes (105cells/well) were seeded in 6-well plates and stimulated with different concentrations of recombinant rat IL-1β (Sigma, L2880) for 72 h and harvested for mRNA and protein analysis. Mimic-miR-7-5p, mimic-miR-NC, inhibitor-miR-7-5p and inhibitor-miR-NC were purchased from Gene Pharma Co., LTD (Shanghai, China). The transfection of miR-7-5p mimic/inhibitor and the pLVX-ATG4A-IRES-Zsgreen plasmid in chondrocytes was performed using lipo2000 reagent (Invitrogen, 116680-019) according to the manufacturer’s instruction.
The co-culture assay
The rat chondrocytes were treated with IL-1β for 24 h and then were resuspended at a density of 1×105cells/ well (2ml) and seeded in the lower chambers (6-well migration chambers, 0.4 µm pore membrane, 83.3930.041, SARSTEDT, German). The step of the transfection of miR-7-5p mimic/miR-NC and the pLVX-ATG4A-IRES-Zsgreen plasmid in chondrocytes, was optional, of which the culture medium changed after 8h of transfection. Subsequently, the upper chambers were seeded with rat ADSCs of 1×105cells/well in 6-well plates filled with DMEM/F12 medium supplemented with 10% FBS, and incubated at 37°C with 5% CO2 and humidified incubator. After 72 h incubation, the lower rat chondrocytes were harvested for mRNA and protein analysis, IF and autophagic flux detection.
Quantitative reverse transcription-polymerase chain reaction
Total RNA was extracted from tissues or cultured cells using Trizol reagent (Invitrogen, 15596-026). The first-strand cDNA was synthesized using HiScript® III 1st Strand cDNA Synthesis Kit (Vazyme, R312-02). Real-Time PCR was performed using ChamQ™ Universal SYBR® qPCR Master Mix (Vazyme, Q711-03) on a light cycler (Roche, Basel, Switzerland) to determine the expression of mRNAs, using GAPDH as an endogenous control. Besides, miRNA specific real-time qPCR was conducted following the manufacturer’s guidelines (Vazyme, Q711-03), and U6 small nuclear RNA (snRNA) was used as a control to quantify miRNAs. Primer sequences are presented in Table 1.
Table 1
The primer sets for qPCR were listed below.
Gene | Forward primer (5’-3’) | Reverse primer (5’-3’) |
rno GAPDH | GGTCGGTGTGAACGGATTTGG | GCCGTGGGTAGAGTCATACTGGAAC |
rno SOX9 | CTGAAGGGCTACGACTGGAC | TACTGGTCTGCCAGCTTCCT |
rno COL2A1 | CCCCTGCAGTACATGCGG | CTCGACGTCATGCTGTCTCAAG |
rno MMP-13 | GTGACCCAGCCCTATCCCT | TTGGTCAAAAACAGTTCAGGCT |
rno COL10A1 | ACCTCCCAGCCAAGCAGTC | GCCTGTTGTACAGAATCTCATCAAA |
rno COL1 | GGACACTACCCTCAAGAGCC | TCTCCGCTCTTCCAGTCAGA |
rno U6 | CTCGCTTCGGCAGCACA | AACGCTTCACGAATTTGCAT |
rno miR-7-5p | CGGCGGTGGAAGACTAGTGATT | ATCCAGTGCAGGGTCCGAGG |
rno miR-7-5p stem loop primer | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACAACA |
Western blot analysis
The cartilage and cells were prepared in RIPA lysis buffer (Epizyme, PC101) addition with protease inhibitor cocktail (Epizyme, GRF101) and phosphatase inhibitor cocktail (Epizyme, GRF102). The protein concentration was examined using a BCA protein assay kit (Takara, T9300A), and immediately boiled for 10 min with loading buffer addition. Equal amount of protein extracts (20 µg) was loaded to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel for electrophoresis and transferred to PVDF membrane. Subsequently, the PVDF membrane was orderly incubated with primary antibodies and secondary antibodies. At last, the enhanced chemiluminescence (BI, 20-500-120) was added to react with secondary antibodies and the images were obtained. The antibodies used were COL2A1-antibody (Abcam, ab188570), MMP13-antibody (Proteintech, 18165–1–AP), Sox9-antibody (Invitrogen, PA5-81966), Beclin1-antibody (CST, 3495), LC3 A/B-antibody (CST, 12741), ATG3-antibody (CST, 3415), LAMP1-antibody (Invitrogen, MA1-164), ATG4A-antibody (CST, 7613), p70S6(CST, 9202), p-p70S6(CST, 9234), S6(CST, 2217), p-S6(CST, 4548), anti-rabbit IgG, HRP-linked Antibody (CST, 7074), anti-mouse IgG, HRP-linked Antibody (CST, 7076).
Autophagic flux analysis
The adenoviral vector carrying RFP-GFP-LC3 (HB-AP2100001) were purchased from HANBIO. This construct fluorescence depends on the difference in pH between the acidic autolysosome and the neutral autophagosome, and the exhibited red/green (yellow) or red fluorescence makes it possible to monitor progression of autophagic flux. To analyze the autophagic flux in rat chondrocytes, the cells were planted on cover slips that had been retained in 6-well plates were treated with: induced with IL-1β, or transfection of miR-7-5p mimic/miR-NC, or co-culture with ADSCs, up to the need of the trial. Subsequently the cells were infected with the RFP-GFP-LC3 adenovirus for 24h. Finally cultured cells on the cover slips were washed in cool PBS and fixed in 4% PFA, stained the nuclear with DAPI for immunostaining and detected for the images using a laser scanning confocal microscope (Leica, TSC SP8). For each condition, at least 6 RFP-GFP-LC3-transfected images were subjected to fluorescence analysis, and the percentage of transfected cells showing puncta RFP-GFP-LC3 were used to indicate the accumulation of autophagosomes.
Dual-Luciferase reporter assay
The bioinformatics online software miRDB and TargetScan were used to predict target genes and analyze whether there are binding sites between miR-7-5p and ATG4A. The wild-type ATG4A dual-luciferase reporter vector (WT ATG4A) and mutant ATG4A dual-luciferase reporter vector (MUT ATG4A) were construct respectively, and then co-transfected with miR-7-5p mimic as well as the negative control into C28/I2 cells. A miRNA control was used as a negative control. Luciferase activity was determined 48h post-transfection, and reporter assays were performed following the manufacturer’s protocol of a dual luciferase activity detection kit (Promega, E1910). Renilla luciferase activity was normalized to firefly luciferase activity and expressed as a percentage of the control.
Statistical analysis
All experiments were performed in duplicate or triplicate and observed by independent observers. Differences between two groups were analyzed using Student’s t-test while those among three groups were analyzed by one-way analysis of variance (ANOVA) and Tukey’s multiple comparison test. All statistical analyses were performed with GraphPad Prism 8.0 (GraphPad Software Inc., La Jolla, CA, USA). The results are presented as the mean ± standard error (SEM), and p < 0.05 was considered statistically significant.