Microbial material
B. subtilis EBS03 comes from the cotton biocontrol bacteria population resource database established by our research group (Yuan et al. 2017; Wei et al. 2021). The isolated bacterium was stored as a frozen glycerol stock (−80 ℃) and maintained Luria-Bertani (LB) at 37 ℃. The strongly virulent defoliating V. dahliae strain Vd080 was used to infect cotton, which was separated from the diseased soil in Xinji, Hebei province, China (37˚56’N, 115˚15’E). Upland cotton (Gossypium hirsutum) cultivars, Lumianyan 21 (tolerance), were used in the tests (Li et al. 2009).
Detection of the antagonistic effect of endophytic bacteria on V. dahliae
Preparation of fungal spore and bacterial cell suspensions
B. subtilis EBS03 was activated on LB solid medium and a single colony was picked and placed in LB liquid medium and maintained at 37 ℃, 150 r·min-1, after 24 h of shaking culture, the cultured broth of B. subtilis was obtained for use. A diameter of 5 mm of the fungal colony of Vd080 was taken and transferred to the Czapek solution at 25 ℃, 150 r·min-1, after 7 days of shaking culture, the Vd080 spore suspension was obtained for use.
Nonvolatile metabolite inhibitory assay
In vitro confrontation, bioassays were performed on PDA by placing a 5 mm plug of actively-growing mycelia in the center of a 100 × 15 mm petri dish. Then, two oxford cups were symmetrically placed 20 mm from the center of the medium, and 50 μL of B. subtilis was added to each cup. Controls were prepared by placing a fungal plug in the center of a PDA dish without bacterial inoculations. All petri dishes were incubated at 25 ℃, and each treatment was repeated 5 times, after 10 days of incubation, determination of colony diameter of V. dahliae by the crisscross method. Following incubation, growth was recorded and the percentage of inhibition was calculated according to the following formula: percent inhibition (I): I = [(D1 – 5) - (D2 - 5)] / (D1 - 5) × 100%(China National Institute of Standardization. 2020), where D1 = average diameter of the fungal thallus of control treatments (mm) and D2 = average diameter of the fungal thallus of B. subtilis EBS03 treatments (mm).
Volatile metabolite inhibitory bioassay
Inhibition of V. dahliae mycelial growth by volatiles of EBS03 was tested using the buckle culture method. Inoculated 5 μL of B. subtilis EBS03 in one fresh PDA petri dish, and another fresh PDA petri dish containing a mycelial plug (5 mm diameter) of V. dahliae Vd080 was placed inversely over the petri dish containing the culture of EBS03; this double-dish set was immediately sealed with parafilm. In the control treatment, a PDA petri dish inoculated with V. dahliae Vd080 was placed inversely over another petri dish containing LB but without EBS03 to make a double-dish set. Each treatment was repeated 5 times. The diameter of the V. dahliae Vd080 colony in each double-dish set was measured 10 days after incubation at 25 ℃, and the percentage of growth inhibition was calculated using the method described above.
Antifungal activity of B. subtilis EBS03 on sporulation of V. dahliae.
Culture filtrate of EBS03 (10 mL) was added to a 50 mL sterile erlenmeyer flask, and then 10 mL spore suspension (1 × 107 spores·mL-1) of Vd080 cultured in liquid Czapek medium was added. The same volumes of liquid LB medium and spore suspension of Vd080 were added to another flask as the control. The flasks were shaken at 150 r﹒min-1 for 48, 72 and 96 h at room temperature (25 ℃). Spore concentrations were estimated with a hemocytometer. Each treatment was repeated 5 times.
B. subtilis EBS03 inhibited the germination of V. dahliae Vd080 microsclerotia
The endophytic bacterial culture was centrifuged at 5 000 r·min-1 for 10 min at 4 ℃. Filter the supernatant through a 0.22 μm filter to sterilize. Took 100 μL of sterile filtrate stock solution, 1/2 dilution solution and 1/4 dilution solution, and mixed them evenly with an equal amount of Vd080 spore suspension (1 × 107 spore·mL-1). The same volumes of liquid LB medium and spore suspension of Vd080 were added to another 1.5 mL centrifuge tube as the control. These experiments were incubated for 18 h at 18 ℃ in the dark. Following the incubation period, Germination rates were observed under visible light using an inverted microscope. Observe the germination of 100 microsclerotia each time. Each treatment was repeated 5 times, microsclerotia was considered germinated when the length of the germ tube equaled at least the length of the microsclerotia.
Control effect of strain EBS03 on Verticillium wilt of cotton
A greenhouse experiment to determine the effect of control
Seed soaking method: vermiculite, sand and nutritious soil were mixed evenly according to the mass ratio at 3: 2: 1 and then loaded into a paper bowl (diameter 6 cm, height 10 cm). Cotton seedling cultivation and pathogen inoculation methods refer to our previous method (Zhu et al. 2010). At the same time, the cotton seeds of Lumianyan 21 were soaked in an EBS03 culture medium for 12 h, and 8 cotton seeds were sown in each paper bowl, one treatment per 6 paper bowls, each treatment was repeated 3 times, and the aseptic LB soaking seeds were used as the control. The seedlings were carried out 7 days after sowing, and 5 cotton seedlings were retained in each bowl. When a true leaf first appeared, each paper bowl was inoculated with 10 mL Vd080 spore suspension (1 × 107 spore·mL-1). The cotton growth situation was tracked and the cotton Verticillium wilt disease was investigated in time.
Root irrigation method: soaking cotton seed Lumianyan 21 in warm soup for 12 h, sowing and fixing seedlings refer to the soaking method. After the first appearance of a true leaf of cotton, the roots were irrigated with 10 mL spore liquid of EBS03 culture medium. 3 days after treatment, each paper bowl was inoculated with 10 mL Vd080 spore suspension (1 × 107 spore·mL-1), one treatment for every 6 paper bowls, each treatment was repeated 3 times, and the same amount of water was irrigated used as control.
15 days after inoculation of Vd080 spore suspension, the Verticillium wilt disease was investigated, and the disease index (DI) and disease prevention effect were calculated at the same time (Zhao et al. 2017; Zhang et al. 2021). At 60 days after sowing, 15 cotton plants were randomly selected to measure the biomass indexes such as plant height, root length, fresh matter quality and so on. The disease index of cotton Verticillium wilt was calculated as DI = Σ (Ni × I) / (N × 4) × 100. In the formula, DI is the disease index, Ni is the number of diseased plants at all levels, I is the number of disease grades, and N is the total number of plants investigated. The formula for calculating the control effect (E) is E (%) = (DI0 - DI1) / DI0 × 100, DI0 is the control disease index and DI1 is the treatment disease index.
A field experiment to determine the control effect
The disease-tolerant variety Lumianyan 21 was planted in the disease nursery where Verticillium wilt occurred seriously. The planting plot was designed according to the experiment, each zone was 3.3 m long and 2.8 m wide, and the plant distance was 20 cm, each experiment was set to repeat 3 times.
Soaking seeds in EBS03 fermentation broth: soaking appropriate amount of sterilized seeds in EBS03 culture solution for 12 h, washing seeds with sterile water many times before sowing, counting the emergence number of Lumianyan 21 seeds, and calculating seedling emergence rate at 10 days after sowing, 15 cotton seedlings were randomly selected from each treatment at 25 days after emergence to measure the root length, plant height and fresh material quality. Root irrigation with EBS03 fermented liquid: after cotton emergence, EBS03 culture liquid was irrigated on the cotton root with 0.8 L per zone and sprayed on the cotton seedling. EBS03 fermentation liquid spray: the prepared EBS03 fermentation liquid was sprayed on cotton seedlings, and sprayed once every 20 days, a total of 2 times, 0.4 L per zone, with the same amount of water spray as the control. The classification standard, disease index, and control effect of the Verticillium wilt disease were the same as the greenhouse experiment to determine the effective control of EBS03. Furthermore, the plant height, fruit branch number, boll number per plant, 30 boll seed quality, and 30 boll lint quality were investigated during the cotton harvest.
Study on the mechanism of strain EBS03 controlling Verticillium wilt of cotton
Detection of resistance of cotton leaves induced by strain EBS03
Soaked the sterilized seeds in an activated EBS03 medium for 12 h, rinsed the seeds with sterile water 2 times, and sowed 8 seeds in a paper bowl. After the cotton seedlings grew to 3 true leaves, they were irrigated with an EBS03 culture medium for root treatment. After 2 days, the true leaves of cotton were taken for surface disinfection, then washed with sterile water 2 times, placed on the surface of a water agar plate, and each leaf was inoculated with 5 mm of the fungal colony of V. dahliae. The leaves were cultured at 25 ℃ for 7 days, and the damage to leaves was observed. Inoculated with LB liquid medium alone as a control, each treatment was repeated 5 times.
Detection of reactive oxygen species burst in cotton leaves induced by strain EBS03
When 2 true leaves of cotton were grown, the roots were irrigated with 10 mL of an EBS03 culture medium per bowl. 2 days after inoculation, the eruption and accumulation of reactive oxygen species in cotton leaves were detected by 3, 3’-diaminobenzidine (DAB) tissue staining method. The true cotton leaves with similar growth were washed with sterile water and placed in 50 mL centrifuge tubes. An appropriate amount of DAB staining solution (1 g·L-1, pH 7.5) was added to the centrifuge tube and stained at room temperature for 8 h. After removing the dye solution, added an appropriate amount of 95% ethanol in the boiling water bath for 2 min to remove chlorophyll, remove the liquid add the appropriate amount of anhydrous ethanol to continue decolorization until the green leaves were completely removed. Finally, the leaves were soaked in 70% (volume fraction) of glycerol, the intercellular bubbles were driven out, and the leaves were placed on glass slides and observed by fluorescence microscope Nikon80i.
Determination of callose deposition in cotton plants induced by strain EBS03
When the cotton seedlings grow 2 true leaves, inoculate the culture solution of strain EBS03, 10 mL per pot. After inoculation with EBS03 medium for 2 days, the cotton true leaves with similar growth were washed with sterile water and placed in a 50 mL centrifuge tube. The whole leaves were fixed in a fixed solution with a volume ratio of ethanol to acetic acid at 3: 1 for 3 h, and chlorophyll was removed. Soaked in 70% and 50% ethanol for 3 h, then soaked in sterile water overnight. After pouring water the next day, rinsed the leaves gently and treated the leaves in 10% (mass fraction) NaOH for 2 h to make the leaves transparent. The leaves were washed with distilled water 4 times, then cultured in 0.01% (mass fraction) aniline blue for 3 h, and finally, the amount of callose was observed by fluorescence microscope Nikon80i.
Determination of defense-related gene expression in cotton induced by strain EBS03After the first true leaf of cotton appeared, the roots were irrigated with an EBS03 culture medium. 3 days after treatment, 10 mL Vd080 spore suspension (1 × 107 spore·mL-1) was inoculated in each paper bowl, and the root was irrigated with the same amount of water as the control, each treatment was repeated 3 times. At 24 h, 48 h and 72 h after the infection of cotton by V. dahliae, the leaves of cotton were collected to detect the expression of defense-related genes. RNA was extracted from cotton leaves by RNAprepPurePlantKit (TIANGEN). The concentration of RNA was detected by NanoDrop 2000, and the concentration of RNA was adjusted to 100 ng﹒μL-1. According to Zhang et al (2016) method, the expression of defense-related genes peroxidase (POD), polyphenol oxidase (PPO), phenylalanine aminolase (PAL), and disease-resistance-related gene (PR10) in cotton leaves were detected. The highly conserved gene Ubiquitin in cotton was used as the internal reference, and the relative expression levels of genes were calculated using the 2-ΔΔCt method (Huang et al. 2021). The specific primers of defense genes were shown in Table 1.
Table 1 Specific primer sequences of related resistance genes
Gene name
|
Primer sequence(5'-3')
|
POD
|
F: CCGCATAACCATCACAAG
|
R: ACTCTCATCACCTTCAACA
|
PPO
|
F: ATATCCTTGTTCTGTCTGCTA
|
R: CTCCTTCTACCGTCTCTTC
|
PAL
|
F: TGGTGGCTGAGTTTAGGAAA
|
R: TGAGTGAGGCAATGTGTGA
|
PR10
|
F: ATGATTGAAGGTCGGCCTTTAGGG
|
R: CAGCTGCCACAAACTGGTTCTCAT
|
β-tubulin
|
F: AACAACAGTCCGATGGATAATTC
|
R: GTACCGGGCTCGAGATCG
|
Ubiquitin
|
F: GAGTCTTCGGACACCATTG
|
R: CTTGACCTTCTTCTTCTTGTGC
|
Detection of V. dahliae colonization in cotton tissue by qPCR
After the first true leaf of cotton appearances, the roots were irrigated with an EBS03 culture medium, and 10 mL Vd080 spore suspension (1 × 107 spore·mL-1) was inoculated in each paper bowl after 3 days. The hypocotyls of cotton seedlings were collected 5 days after inoculation. The qPCR reaction system and reaction conditions were the same as described above. The highly conserved gene Ubiquitin in cotton was used as the internal reference gene, and the β-tubulin gene of V. dahliae was used as the detection gene (Zhang et al. 2015). Determination of V. dahliae biomass in cotton hypocotyls (Sun et al. 2014).
Statistical Analyses
Data entry and analysis were performed using Microsoft Excel 2019. All the data were statistically analyzed using SPSS version 26 by one-way analysis of variance (ANOVA). The obtained means ± standard deviation were compared by Duncan’s post hoc multiple range test and were considered significant at p < 0.05.