COL1A1 and COL3A1 elevation and regulation by β2-microglobulin in subsynovial connective tissues of patients undergoing hemodialysis with carpal tunnel syndrome

doi:10.21203/rs.3.rs-1872629/v1

Download PDF

Research Article

COL1A1 and COL3A1 elevation and regulation by β2-microglobulin in subsynovial connective tissues of patients undergoing hemodialysis with carpal tunnel syndrome

https://doi.org/10.21203/rs.3.rs-1872629/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Purpose: Carpal tunnel syndrome (CTS) constitutes a typical complication of patients receiving long-term hemodialysis (HD). However, the mechanisms underlying the manifestation of CTS in patients receiving long-term hemodialysis remain to be studied. We investigated collagen gene expression in the subsynovial connective tissue (SSCT) of patients undergoing hemodialysis and evaluated the effect of β2-microglobulin (B2M) on collagen gene expression in cells derived from the SSCT.

Methods: To study the expression of collagen genes in the SSCT of HD and non-HD patients, SSCT specimens were obtained from 64 patients with CTS (47 non-HD and 17 HD) during carpal tunnel release (CTR). To evaluate the fibrotic condition of SSCTs, COL1A1 and COL3A1 expression were evaluated using qPCR. To evaluate the effect of B2M on collage genes, SSCT cells were stimulated in α-MEM with 0.5% fetal bovine (vehicle) or 1 or 10 µg/ml B2M.

Results: Expressions of both COL1A1 and COL3A1 in the HD group were significantly higher than those in the non-HD group (COL1A1, P=0.021; COL3A1, P=.0.031). Incubating SSCT cells together with B2M for 6 h and 24 h led to increased mRNA expression of COL3A1 compared to that observed in vehicle control cells (p<0.001

Conclusions: Our findings suggest that increased expression of COL1A1 and COL3A1 may be one mechanism by which HD patients develop CTS. Further, B2M may be responsible for elevating COL3A1 expression in HD patients with CTS.

Carpal tunnel syndrome (CTS) constitutes a typical complication of patients receiving long-term hemodialysis (HD) [1–6]. Its prevalence shows an association with the length of hemodialysis [1, 4], with CTS having been reported in 32–50% of patients over 10 years following the initiation of hemodialysis [4, 7] and in 80% of patients more than 30 years later [7]. However, the mechanisms underlying the manifestation of CTS in patients receiving long-term hemodialysis remain to be studied.

According to recent studies, fibrosis associated with increased collagen synthesis in the subsynovial connective tissue (SSCT) surrounding the median nerve and tendon could be a marker of the development and pathology of idiopathic CTS [8, 9]. However, several types of organ and tissue fibrosis are observed in patients with hemodialysis [10, 11]. One type, known as dialysis-related amyloidosis, involves the laying down of insoluble fibrils of β2-microglobulin (B2M) [12, 13]. According to several reports, B2M may act as an inflammatory cytokine, promoter of aging, and fibrosis-related factor [14–19]. Further, B2M plays a role in the formation of fibrosis in the kidney, heart, and liver [20–23]. Importantly, amyloid deposits are present in the synovial tissue of patients receiving dialysis with CTS [24–26]. However, how B2M affects collagen synthesis in the SSCT remains unclear.

We hypothesized that levels of collagen are increased in the SSCT of patients receiving hemodialysis with CTS and that B2M controls these changes. To test this, we investigated collagen gene expression in the SSCT of patients undergoing hemodialysis and evaluated the effect of B2M on collagen gene expression in cells derived from the SSCT.

Patients

The present study was approved by the Ethics Committee at our institute (Clinical Research Review Board of the Kitasato Institute; reference number: KMEO B13-113) and abides by the 1964 Helsinki Declaration and its later amendments or comparable ethical standards. All participants gave written informed consent.

To study the expression of collagen genes in the SSCT of HD and non-HD patients, SSCT specimens were obtained from patients with CTS during carpal tunnel release (CTR). A total of 110 patients underwent CTR. Given that the body mass index (BMI) is a reported risk factor for the formation of CTS [27], we excluded 46 patients who were overweight or obese (BMI ≥ 25 kg/m). All patients underwent diagnostic neurophysiological tests comprising electromyography and nerve conduction studies based on the American Association of Electrodiagnostic Medicine standards and received confirmed diagnosis of CTS [28]. We further excluded patients with a history of thyroid disease, rheumatoid arthritis, osteoarthrosis, degenerative joint disease, flexor tendinitis, sarcoidosis, amyloidosis, peripheral nerve disease, or traumatic injuries to the ipsilateral arm based on their medical charts. Finally, 64 patients with CTS (47 non-HD and 17 HD) were included in this study.

In our study of the pathological role of B2M in patients with CTS, two men and four women with an age range of 52–71 years [mean ± standard deviation (SD), 66.8 ± 7.5 years] were excluded because they had a history of thyroid disease, rheumatoid arthritis, osteoarthrosis, degenerative joint disease, flexor tendinitis, sarcoidosis, amyloidosis, peripheral nerve disease, or traumatic injuries to the ipsilateral arm.

SSCT cell culture

SSCT specimens were treated with 20 ml of 0.1% type I collagenase derived from clostridium histoluticum (Wako Pure Chemicals, Osaka, Japan) for one day at 37°C. SSCT cells were maintained in culture for two weeks in α-MEM with 10% fetal bovine serum (FBS) and 20 mg/ml basic fibroblast growth factor (bFGF). To eliminate any effects of 10% FBS and bFGF on collagen gene expression, cells were washed twice with α-MEM and the medium was replaced α-MEM containing 0.5% FBS. Three hours after replacing the medium, SSCT cells were stimulated in α-MEM with 0.5% fetal bovine (vehicle) or 1 or 10 µg/ml B2M.

Real-time PCR

SSCT cells were homogenized with TRIzol Reagent using a homogenizer. The mixture was centrifuged to obtain the supernatant, from which total RNA was subsequently extracted by Direct-zolTM RNA Micro Prep (Zymo Research, Irvine, CA) based on the manufacturer's protocol. The SuperScriptIII First-Strand Synthesis Super Mix kit (Life Technologies, ThermoFisher, Waltham, MA) was then used to conduct cDNA synthesis, with the purified total RNA as the template. Primers used in the PCR assay are listed in Table 1. To examine COL1A1 and COL3A1 mRNA expression, real-time PCR analysis (MiniOpticon, Bio Rad, USA) was conducted using PCR Master Mix (Takara SYBR® PreMix Ex Taq II). mRNA expression levels were normalized to that of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and analyzed using the delta-delta CT method.

Statistical analysis

Shapiro-Wilk's test was used to ascertain whether the data were normally distributed. In the comparison of collagen expression in the SSCT of HD and non-HD patients, variables that were not normally distributed were analyzed using the Mann-Whitney test. In the study of the pathological role of B2M in patients with CTS, data were compared by one-way repeated measures ANOVA and pairwise comparison with Bonferroni adjustment. P < 0.05 determined in SSPS software v19.0 (IBM, USA) was used to indicate statistical significant.

Patient demographics

Patients in the HD and non-HD groups showed comparable age and BMI (age, P=0.416; BMI, P=0.135; Table 2). The proportion of male to female patients was likewise similar between the two groups (P=0.0.152; Table 2).

Expression of collagen genes in SSCT of HD and non-HD patients

To evaluate the fibrotic condition of SSCTs, COL1A1 and COL3A1 expression were evaluated using qPCR. Expressions of both COL1A1 and COL3A1 in the HD group were significantly higher than those in the non-HD group (COL1A1, P=0.021; COL3A1, P=.0.031; Figure 1A, B).

Impact of B2M on collagen gene expression in SSCT cells

Incubating SSCT cells together with B2M for 6 h and 24 h led to increased mRNA expression of COL3A1 compared to that observed in vehicle control cells (p<0.001, Fig. 2A). Further, according to Bonferroni's multiple comparisons test, stimulating SSCT cells with 10 ng/ml B2M for 24 h had no significant effect on collagen COL3A1 expression relative to stimulation with 1 ng/ml B2M (p=0.103), but significantly increased expression compared to the control group (p=0.045). In contrast, SSCT cells stimulated with 10 ng/ml B2M for 6 h produced significantly higher levels of COL3A1 than those stimulated with 1 ng/ml B2M (p=0.014) and the control group (p=0.0.017).

Meanwhile, neither 6-h (p = 0.881) nor 24-h stimulation (p=0.417) with B2M had any significant impact on COL1A1 mRNA expression (Fig. 2B).

The present study demonstrated that COL1A1 and COL3A1 levels were elevated in HD patients compared to non-HD patients with CTS. Further, stimulation of SSCT cells with B2M increased COL3A1 expression but not COL1A1 expression, suggesting that the presence of B2M in SSCT cells could contribute to the development of CTS in HD patients.

The SSCT of patients with CTS can develop various pathologies, such as proliferation with thickening of the tendon sheath, fibrosis, and vascular lesions, which can include thickening of vessel walls, intimal hyperplasia, vascular proliferation, and thrombosis [8, 29–33]. Such pathological alterations arise when cells interact with extracellular matrix components like collagen, elastin, and proteoglycans [33–35]. Prior research has reported elevated expression levels of fibrotic factors such as type Ⅰ and type Ⅲ collagen in the SSCT of CTS patients [36]. In addition, an immunohistochemical study reported significantly more intense staining of collagen type III fibers in CTS patients relative to a control group. Further, expressions of COL1A1 and COL3A1 have also been shown to be higher in patients with idiopathic CTS compared to a control group consisting of fresh cadavers. Moreover, type III collagen-positive cells located in the SSCT of patients with CTS are significantly larger than those in healthy controls [36]. This evidence suggests that COL3A1 may be involved in the development of CTS. In the present study, we showed that COL3A1 levels were elevated in HD patients compared to non-HD patients, suggesting that increased COL3A1 may contribute to CTS pathology in HD patients.

B2M, a small membrane protein that binds the heavy chains of class I major histocompatibility complex found on nucleated cells [37], is typically removed by glomerular filtration or later by proximal tubular reabsorption and catabolism [37]. However, patients with end-stage renal disease have significantly reduced catabolism. This leads to increased plasma B2M, which, if allowed to accumulate long-term, deposits into tissues [37]. Prior research conducted using microarray reported that treatment with B2M increased COL3A1 expression in chondrocytes derived from osteoarthritis patients [38]. Consistent with this, the present study demonstrated that the presence of B2M stimulated COL3A1 expression in SSCT cells. Thus, the accumulation of B2M in the SSCT cells of HD patients may contribute to the development of CTS by increasing the expression of COL3A1.

Our findings suggest that increased expression of COL1A1 and COL3A1 may be one mechanism by which HD patients develop CTS. Further, B2M may be responsible for elevating COL3A1 expression in HD patients with CTS.

CTS: carpal tunnel syndrome; HD: hemodialysis; SSCT: subsynovial connective tissue; B2M: beta 2-microglobulin; CTR: carpal tunnel release; BMI: body mass index; FBS: fetal bovine serum; SD: standard deviation; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; MHC: major histocompatibility complex

Ethics approval and consent to participate

This study was conducted with the approval of the Ethics Committee at our institution (Clinical Research Review Board of the Kitasato Institute; reference number KMEO B13-113) and abides by the 1964 Helsinki Declaration and its later amendments or comparable ethical standards.

Consent for publication

Not applicable

Availability of data and materials

Datasets supporting the conclusions of this article are included within the article. The raw data can be requested from the corresponding author.

Competing interests

The authors declare that they have no competing interests.

Funding

This investigation was supported in part by Grant-in-Aid for Scientific Research (C) Grant No. 20K09487.

Authors’ contributions

KM, KO, YY, KS, YO, YM, MN, GI, MT and KU acquired the data. KM, GI, MT, and KU analyzed and interpreted the data. All authors are responsible for the study concept and design, and contributed to writing the manuscript. All authors read and approved the final manuscript.

Acknowledgements

We are grateful to Yuka Ito, Mai Matsumoto, and Yuko Onuki for their helpful support during the study.

Gilbert, M.S., et al., Carpal tunnel syndrome in patients who are receiving long-term renal hemodialysis. J Bone Joint Surg Am, 1988. 70(8): p. 1145-53.
Kessler, M., et al., Dialysis-associated arthropathy: a multicentre survey of 171 patients receiving haemodialysis for over 10 years. The Co-operative Group on Dialysis-associated Arthropathy. Br J Rheumatol, 1992. 31(3): p. 157-62.
Sivri, A., et al., Carpal tunnel syndrome: a major complication in hemodialysis patients. Scand J Rheumatol, 1994. 23(5): p. 287-90.
Harris, S.A. and E.A. Brown, Patients surviving more than 10 years on haemodialysis. The natural history of the complications of treatment. Nephrol Dial Transplant, 1998. 13(5): p. 1226-33.
Hirasawa, Y. and T. Ogura, Carpal tunnel syndrome in patients on long-term haemodialysis. Scand J Plast Reconstr Surg Hand Surg, 2000. 34(4): p. 373-81.
Gejyo, F. and I. Narita, Current clinical and pathogenetic understanding of beta2-m amyloidosis in long-term haemodialysis patients. Nephrology (Carlton), 2003. 8 Suppl: p. S45-9.
Otsubo, S., et al., Characteristics of dialysis-related amyloidosis in patients on haemodialysis therapy for more than 30 years. Nephrol Dial Transplant, 2009. 24(5): p. 1593-8.
Schuind, F., M. Ventura, and J.L. Pasteels, Idiopathic carpal tunnel syndrome: histologic study of flexor tendon synovium. J Hand Surg Am, 1990. 15(3): p. 497-503.
Donato, G., et al., Pathological findings in subsynovial connective tissue in idiopathic carpal tunnel syndrome. Clin Neuropathol, 2009. 28(2): p. 129-35.
Grobner, T., Gadolinium--a specific trigger for the development of nephrogenic fibrosing dermopathy and nephrogenic systemic fibrosis? Nephrol Dial Transplant, 2006. 21(4): p. 1104-8.
Khurana, A., et al., Nephrogenic systemic fibrosis: a review of 6 cases temporally related to gadodiamide injection (omniscan). Invest Radiol, 2007. 42(2): p. 139-45.
Kad, N.M., et al., Beta(2)-microglobulin and its deamidated variant, N17D form amyloid fibrils with a range of morphologies in vitro. J Mol Biol, 2001. 313(3): p. 559-71.
Kad, N.M., et al., Hierarchical assembly of beta2-microglobulin amyloid in vitro revealed by atomic force microscopy. J Mol Biol, 2003. 330(4): p. 785-97.
Santos, M.M., et al., Iron overload and heart fibrosis in mice deficient for both beta2-microglobulin and Rag1. Am J Pathol, 2000. 157(6): p. 1883-92.
Nomura, T., et al., beta2-Microglobulin-mediated signaling as a target for cancer therapy. Anticancer Agents Med Chem, 2014. 14(3): p. 343-52.
Filiano, A.J. and J. Kipnis, Breaking bad blood: beta2-microglobulin as a pro-aging factor in blood. Nat Med, 2015. 21(8): p. 844-5.
Smith, L.K., et al., beta2-microglobulin is a systemic pro-aging factor that impairs cognitive function and neurogenesis. Nat Med, 2015. 21(8): p. 932-7.
Yang, R., et al., Quantitation of circulating GDF-11 and beta2-MG in aged patients with age-related impairment in cognitive function. Clin Sci (Lond), 2017. 131(15): p. 1895-1904.
Boyer, M.J. and S. Eguchi, Novel role for cardiac myocyte-derived beta-2 microglobulin in mediating cardiac fibrosis. Clin Sci (Lond), 2018. 132(19): p. 2117-2120.
Lan, L., et al., Transplantation of bone marrow-derived hepatocyte stem cells transduced with adenovirus-mediated IL-10 gene reverses liver fibrosis in rats. Transpl Int, 2008. 21(6): p. 581-92.
Zhang, A., et al., beta2-microglobulin induces epithelial-mesenchymal transition in human renal proximal tubule epithelial cells in vitro. BMC Nephrol, 2015. 16: p. 60.
Wang, J., et al., Mesenchymal Stromal Cells-Derived beta2-Microglobulin Promotes Epithelial-Mesenchymal Transition of Esophageal Squamous Cell Carcinoma Cells. Sci Rep, 2018. 8(1): p. 5422.
Chen, J., et al., Delphinidin protects beta2m-/Thy1+ bone marrow-derived hepatocyte stem cells against TGF-beta1-induced oxidative stress and apoptosis through the PI3K/Akt pathway in vitro. Chem Biol Interact, 2019. 297: p. 109-118.
Bardin, T., et al., Synovial amyloidosis in patients undergoing long-term hemodialysis. Arthritis Rheum, 1985. 28(9): p. 1052-8.
Gejyo, F., et al., A new form of amyloid protein associated with chronic hemodialysis was identified as beta 2-microglobulin. Biochem Biophys Res Commun, 1985. 129(3): p. 701-6.
Gejyo, F., et al., Serum levels of beta 2-microglobulin as a new form of amyloid protein in patients undergoing long-term hemodialysis. N Engl J Med, 1986. 314(9): p. 585-6.
Boz, C., et al., Individual risk factors for carpal tunnel syndrome: an evaluation of body mass index, wrist index and hand anthropometric measurements. Clin Neurol Neurosurg, 2004. 106(4): p. 294-9.
Cartwright, M.S., et al., Evidence-based guideline: neuromuscular ultrasound for the diagnosis of carpal tunnel syndrome. Muscle Nerve, 2012. 46(2): p. 287-93.
Neal, N.C., J. McManners, and G.A. Stirling, Pathology of the flexor tendon sheath in the spontaneous carpal tunnel syndrome. J Hand Surg Br, 1987. 12(2): p. 229-32.
Fuchs, P.C., P.A. Nathan, and L.D. Myers, Synovial histology in carpal tunnel syndrome. J Hand Surg Am, 1991. 16(4): p. 753-8.
Lluch, A.L., Thickening of the synovium of the digital flexor tendons: cause or consequence of the carpal tunnel syndrome? J Hand Surg Br, 1992. 17(2): p. 209-12.
Ettema, A.M., et al., A histological and immunohistochemical study of the subsynovial connective tissue in idiopathic carpal tunnel syndrome. J Bone Joint Surg Am, 2004. 86(7): p. 1458-66.
Jinrok, O., et al., Vascular pathologic changes in the flexor tenosynovium (subsynovial connective tissue) in idiopathic carpal tunnel syndrome. J Orthop Res, 2004. 22(6): p. 1310-5.
Alguacil-Garcia, A., K.K. Unni, and J.R. Goellner, Giant cell tumor of tendon sheath and pigmented villonodular synovitis: an ultrastructural study. Am J Clin Pathol, 1978. 69(1): p. 6-17.
Masuda, K., et al., Biochemical analysis of collagen in adhesive tissues formed after digital flexor tendon injuries. J Orthop Sci, 2002. 7(6): p. 665-71.
Chikenji, T., et al., Transforming growth factor-beta (TGF-beta) expression is increased in the subsynovial connective tissues of patients with idiopathic carpal tunnel syndrome. J Orthop Res, 2014. 32(1): p. 116-22.
Scarpioni, R., et al., Dialysis-related amyloidosis: challenges and solutions. Int J Nephrol Renovasc Dis, 2016. 9: p. 319-328.
Zhang, H., C.C. Liew, and K.W. Marshall, Microarray analysis reveals the involvement of beta-2 microglobulin (B2M) in human osteoarthritis. Osteoarthritis Cartilage, 2002. 10(12): p. 950-60.

Table 1

Primers used in the study

Gene	Direction	Primer Sequence (5¢–3¢)	Product Size (bp)
*COL1A1*	F	CCCCGAGGCTCTGAAGGT	145
*COL1A1*	R	CACCAGCAATACCAGGAGCA	145
*COL3A1*	F	CCAGGAGCTAACGGTCTCAG	103
*COL3A1*	R	CAGGGTTTCCATCTCTTCCA	103
*GAPDH*	F	TGTTGCCATCAATGACCCCTT	202
	R	CTCCACGACGTACTCAGCG	202

Table 2

Patients’ demographic data

	Hemodialysis	Non-hemodialysis	P value
Age	69.4±6.6	70.3±11.9	P=0.416
Sex (Female/male)	10/7	17/30	P=0.152
BMI	20.4±2.6	21.4±2.3	P=0.135

BMI: body mass index

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

COL1A1 and COL3A1 elevation and regulation by β2-microglobulin in subsynovial connective tissues of patients undergoing hemodialysis with carpal tunnel syndrome

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Conclusion

Abbreviations

Declarations

References

Tables

Additional Declarations

Status:

Version 1