Experimental strains and plasmids
The experimental strains and plasmids are shown in Table 1.
Medium
Liquid LB medium was prepared by dissolving 10 g of tryptone, 5 g of yeast powder, and 10 g of sodium chloride in 800 mL of double-distilled water, adjusting the pH to 7.4, and diluting the solution to 1000 mL. Next, plain agar powder was added to the liquid LB medium to a final concentration of 1.5% to establish solid LB medium. The solid LB medium was autoclaved for sterilization.
Primers
The tatABC cluster of ETEC10407 (a standard ETEC strain) was deleted and replaced with the kanamycin resistance gene. The forward and reverse primers used for PCR amplification to delete tatABC were as follows: 5′-AACGTATAATGCGGCTTTGTTTAATCATCATCTA CCACAGAGGAACATGTAAAGCCACGTTGTGTCTCAA-3′ and 5′-ATATCAAACATC CTGTACTCCATATGACAACCGCCCTGACGGGCGGTTGATTAGAAAAACTCATCGAGCA-3′. The forward and reverse primers used to confirm the deletion were as follows: 5′-AACGTATAATG CGGCTTTGTT-3′ and 5′-ATATCAAACATCCTGTACTCC-3′. Primers were synthesized by SBS Genetech Co. Ltd., Beijing, China.
Reagents And Instruments
The nucleic acid reference ladder was purchased from CusaBio, Wuhan, China. Immobilized pH gradient (IPG) gel strips and the protein quantitative kit were purchased from Amersham Pharmacia. The sequencing trypsin and protease inhibitor cocktail tablets were purchased from Sigma, USA. PCR was performed using the PTC20 amplification system (MJ Research, USA). PROTEAN IEF CELL and Protean II XL cell (BioRad, USA), respectively, were used for isoelectric focusing electrophoresis and vertical electrophoresis. The 4700 MALDI-TOF-MS was used for mass spectrometry (Applied Biosystems, USA). A light microscope (Olympus Tokyo, Japan) was used to observe cell morphological changes.
Experimental Animals
Male New Zealand white rabbits weighing 2–3 kg were purchased from the Institute of Laboratory Animal Sciences, CAMS & PUMC.
Tatabc Deletion And Confirmation Of Tatabc Deletion In Etec
tatABC deletion was achieved using gene deletion primers. First, the kanamycin resistance gene was PCR-amplified using tatABC deletion primers with plasmid pRS551 as a template. Second, according to the homologous recombination technology (Pradel et al. 2003), the amplified kanamycin resistance gene was substituted for tatABC in the ETEC 10407 strain genome using the recombinase expressed by the helper plasmid, pKOBEG. To confirm the deletion of tatABC in ETEC10407, PCR was performed under the following conditions: pre-denaturation at 94°C for 5 min; 30 cycles of 94°C for 1 min, 56°C for 1 min, and 72°C for 2 min; final extension at 72°C for 5 min. PCR products were subjected to 1.5% agarose gel electrophoresis.
Morphological Observation Of Etec
Logarithmic-phase cultures of ETEC 10407 wt, Δtat, and Δtat/pTAT strains were subjected to Gram staining and then observed and imaged using a light microscope.
Animal Toxicity Test
Healthy male rabbits were fasted for 24 h before operation and subjected to ligation of the intestinal segment in accordance with the routine method (Liang et al. 2003). Single colonies of the ETEC 10407 wt ,Δtat, and Δtat/pTAT strains were inoculated in liquid medium and cultured overnight at 37℃. After ligation of the intestinal segment, 1 mL of the bacterial solution (OD600 = 0.5) to be tested was injected into each animal using a sterile syringe. Rabbits were euthanized via embolization of the marginal ear veins at 24 h after the operation. Intestinal segments were removed, cleaned, fixed in 40% formalin, embedded in paraffin, sectioned, stained with hematoxylin and eosin, and observed for pathology under a light microscope. All animal procedures were performed in accordance with the protocols approved by the animal ethics committee of the Chinese Center for Disease Control and Prevention (Beijing, China).
Protein 2-de And Mass Spectrometry
Two types of protein samples (whole cell lysate protein and supernatant protein samples) were prepared as follows: (1) ETEC 10407 wt and Δtat strains cultures were centrifuged at 8,000 × g for 30 min to separate the supernatant (supernatant A), and the bacteria were washed with PBS solution and sonicated, followed by centrifugation at 40,000 × g for 1 h and collection of the supernatant (supernatant B, the whole cell lysate protein sample); (2) 100% trichloroacetic acid was added to supernatant A at a concentration of 10%. The resulting mixture was allowed to stand overnight at 4℃ to ensure full precipitation of the protein, which was collected via centrifugation and rinsed with 96% ethanol (supernatant protein sample). Isoelectric focusing was performed in the following manner: dry IPG gel strips (pH 3–10, 17 cm) were loaded in the rehydration buffer containing 600 µg of the sample (50 V for 12–16 h, 250 V for 30 min, 1000 V for 1 h, and 10000 V for 11–12 h). SDS-PAGE was performed at a constant current of 10 mA for at least 10 h. After electrophoresis, the gel was stained with Coomassie brilliant blue G-250 and destained with 1% acetic acid. Image information was digitized using a UMAX Powerlook 2100XL. Protein expression was evaluated using PD Quest 2-D software. The differentially expressed protein spots were identified with a MALDI-TOF mass spectrometer, and peptide mass spectral identification was performed using the Mascot program and by searching the NCB Inr databases.