Patient tissue samples
76 fresh gastric cancer specimens were collected from gastric cancer patients sensitive (31 cases) or resistant (45 cases) to chemotherapy from Shandong Cancer Hospital and Institute. The fresh tumor samples were preserved in liquid nitrogen immediately after resection. Each specimen was attached to a confirmed pathological diagnosis. All experiments in this study were endorsed by the Ethics Committee of School of Basic Medical Science of Shandong University and complied with the Declaration of Helsinki. Informed consent was obtained from all patients.
Mass spectrometry
GC samples were measured by Intra-solution enzymatic lysis. Mass spectrometry analysis identified the differential proteins. HEK293T cells were transfected with Flag-AKAP8L, after 48h, the anti-Flag antibody was add to enrich protenins binding to AKAP8L. Proteins were separated by SDS-polyacrylamide gel. Then, SDS-polyacrylamide gel was performed with Coomassie brilliant blue,and the binding proteins were measured by mass spectrometry (Maxis II, Advanced Medical Research Institute, Shandong University).
Cell lines and culture
Human gastric cancer cell lines BGC-823 and MKN-45, and human embryonic kidney cell line-293 T, were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). All cells were maintained in DMEM supplemented with 10% FBS and actively passaged for less than 6 months from the time that they were received.
Construction of the Oxa-resistant BGC-823 and MKN-45 cells
BGC-823 and MKN-45 cells were seeded into the 6-well plates. After growing to 70%~80% confluence, the media contained Oxa (10 mg/mL) was added into the wells. At 24 h after drug treatment, the drug-contained media was replaced by fresh media (without Oxa) after the cells were washed by phosphate-buffered saline (PBS) twice. The drug-contained media was again added at the second cell passage and the treatment time was prolonged gradually (for 48 h and 72 h, respectively). The following process was the same as aforementioned. Until the cell sensitivity to Oxa treatment was decreased obviously and became stable, MTT assays were performed to confirm the successful construction of the Oxa-resistant BGC-823 and MKN-45 cells (BGC-823/Oxa and MKN-45/Oxa).
Cell transfection
Before transfection, the BGC-823/Oxa or MKN-45/Oxa cells were seeded in the 12-well plates. When growing to 30%–40% confluence, 1 mL fresh media supplemented with 10 μl polybrene (Obio technology) and 5 μl lentiviruses (LV-AKAP8L or LV-AKAP8L shRNA-1, shRNA-2) were added into each well. Puromycin (1 μg/mL) (Solarbio, P8230) was used to establish the stable AKAP8L overexpression or knockdown cell lines.
For knockdown of SCD1 or IGF2BP1, siRNAs against SCD1 or IGF2BP1 (siRNA), and a NC siRNA (Ribo, Guangzhou, China) were transfected into the BGC-823/Oxa cells using lipofectamine 2000 according to the manufacture’s protocol. After being incubated for 6~8 h, the cells were washed by PBS twice and the fresh media (supplemented with 10% FBS) were added for another 24 h to 48 h incubation. Then the cells were collected and used for qPCR assay, Western blotting, MTT assay, sphere formation assay and so on. The target sequences for shRNA or siRNA as follows: shAKAP8L-1: CCGCAGTATTCTCAACAACAA, shAKAP8L-2: CGTCACTAACAAGACCAAGAA, siSCD1: CTACGGCTCTTTCTGATCA, siIGF2BP1: GGCTCAGTATGGTACAGTA.
MTT assay
In brief, 2×103/mL suspended cells were plated per well in 96-well plates. After incubation for 24 h at 37°C with 5% CO2, 100 μl drug-contained media were added into each well by certain concentration gradients for Oxa, 0, 5, 10, 15, 20, 25μg/mL). 24 h later, add 10 μl MTT reagent (5 mg/mL) (Sigma) to per well and incubate for another 2~4 h. Then 150 μl/well dimethyl sulfoxides were used to terminate the reaction. After concussion for 10 min in a low speed, the absorbance values were recorded at 570 nm using an enzyme-linked immunometric meter (SpectraMax M5, USA).
Mammosphere formation assay
BGC-823/Oxa or MKN-45/Oxa cells were plated in ultralow attachment six-well plates at a low density of 1×104 viable cells/mL. Cells were maintained in DMEM supplemented with B27, 20 ng/mL EGF, and 20 ng/mL bFGF for two weeks. The mammospheres > 50 μm were photographed and counted using inverted microscope.
Soft agar colony formation assay
Soft agar assays were done by seeding cells at a density of 2×103 in 24-well plate containing 0.3% top low-melt agarose and 0.6% bottom low-melt agarose. Cells were fed every 3 days, and colonies > 50 μm were counted using inverted microscope after two weeks.
Flow cytometry analysis
To assess the cell apoptosis in vitro, cells were analyzed with Annexin V Apoptosis Detection kit (Vazyme Biotech,China) according to the manufacture’s instructions. Cells were examined by flow cytometry(CytoFLEX, Beckman Coulter).
Animal study
Animal experiments were carried out according to the policy of the animal welfare and were approved by the Ethics Committee of School of Basic Medical Science of Shandong University. To construct the subcutaneous gastric tumor model, 1×106 NC BGC-823/Oxa and AKAP8L-overexpression BGC-823/Oxa cells were, respectively, injected into 4 to 5-week-old nude mice after being diluted with PBS to 100 μl (the mice were bought from Weitong lihua, China). The drug was injected intraperitoneally (100 μl/d PBS for the control group, 0.1 mg/kg/d Oxa for the treatment group) once a week. Tumor nodule volumes were measured every three days using the formula: V = π × (d2 × D)/2, where d was the minor tumor axis and D was the long diameter, until day 27. After euthanatized on day 28, tumors were collected and weighted.
Quantitative real-time PCR
Total RNA was isolated using Trizol reagent (Invitrogen, California, USA) following the manufacturer's instructions. One microgram of total RNA was reverse transcribed using Reverse Transcriptase kit (Thermo Fisher Scientific, Waltham, USA). Quantitative real-time PCR was performed with Ultra SYBR Mixture (CWBIO, China) on a CFX96 Real Time PCR Detection System (Bio-Rad, USA). The PCR primers are shown in Supplemental Table S2. The relative levels of gene expression were represented as ΔCt-Ct gene-Ct reference, and the fold change of gene expression was calculated by the 2−ΔΔCt method. Each sample was practiced in triplicate. GAPDH was used as an internal control for all samples.
RNA immunoprecipitation(RIP)
The RIP-Assay Kit (Geneseed, Guangzhou, China) was used to detect interaction of AKAP8L and SCD1 according to the manuscript’s instruction. Briefly, 5×107 BGC-823/Oxa or MKN-45/Oxa cells were harvested and lysed in lysis buffer containing protease inhibitor cocktail and RNase inhibitor. The cell extract was incubated with 25 μL of protein A/G magnetic beads for 4 h at 4 °C (Magnetic beads were pre-incubated with anti-AKAP8L (Novus) antibody or normal rabbit IgG (CST) polyclonal antibody for 2 h at 4 °C). Next, RNA was isolated from the antibody-immobilized protein A/G beads complex. RNA enrichment was analyzed using qPCR.
RNA degradation assay
Twenty-four hours after cell seeding, actinomycin D (ActD, Apexbio) were, respectively, used at a final concentration of 50 mM and 10 μg/mL. Cells were collected at indicated times (0, 2, 4, 6 and 8 h after actinomycin D treatment) and the expression of SCD1 and GAPDH mRNA were detected by qPCR.
Gene-specific m6A qPCR
The MeRIP Kit (BersinBio,China) was used to investigate the expression of m6A-modified SCD1 levels according to the manuscript’s instruction. Total RNA was isolated from BGC-823/Oxa cells by Trizol extraction. Anti-m6A antibody and Protein A/G magnetic beads were added to the mixture and incubated for 4 h at 4 °C with rotation about 10r/min. m6A RNA was purified by RNA purification kit. The m6A enrichment was analyzed using qPCR.
Western blot
Total protein was isolated using RIPA buffer (Solarbio) supplemented with protease inhibitor cocktails (Sigma). The proteins were separated by SDS-polyacrylamide gel, transferred onto polyvinylidene fluoride membranes (Millipore). After blocking with 5% fat-free milk for 2h at RT, then membranes were incubated with primary antibodies overnight at 4°C, followed by peroxidase-conjugated secondary antibodies (1:5000 dilution) for 2h at RT. The immune complex was visualized by an enhanced chemiluminescence kit (Millipore). The primary antibodies were used at the following dilutions: AKAP8L (1:1000, NBP2-47440, Novus), Lgr5 (1:1000, NBP1-28904, Novus), Oct4 (1:1000, NB100-2379, Novus), CD133 (1:1000, #64326, CST), CD44 (1:1000, #37259, CST), Sox2 (1:1000, #3579, CST), SCD1 (1:1000, DF13253, Affinity), IGF2BP1(1:1000, ab184305, abcam), Cleaved-PARP (1:1000, AF7023, Affinity), PARP (1:1000, #9532, CST), Cleaved-Caspase3(1:1000, #9664, CST), Caspase3(1:1000, #AF6311, Affinity), β-actin (1:2000, #4970, CST), GAPDH(1:1000, #2118, CST).
Co-immunoprecipitation (Co-IP)
Cells were collected 24h after transfection and lysed in lysis buffer supplemented with a protease inhibitor cocktail (Sigma), and a phosphatase inhibitor cocktail (Sigma). Supernatants were collected and incubated with the protein A/G beads (MCE) and anti-Flag magnetic beads (Sigma) overnight at 4 °C. Then, beads were washed 5 times with lysis buffer. Immunoprecipitates were eluted by boiling with 2×SDS loading buffer.
Immunohistochemical assay
Immunohistochemical assay was performed to detect the expression of AKAP8L, SCD1, and CD133 in the sections of human gastric cancer tissue arrays or mouse xenograft tissues. In brief, paraffin-embedded slices (4 μm) were deparaffinized, and then boiled in 0.01 M citrate buffer (pH 6.0) for 15 min. The endogenous peroxide activity was blocked in 3% H2O2 solution for 30 min, and the sections were incubated with 5% BSA to reduce nonspecific binding. Tissue sections were incubated with the primary antibodies (anti-AKAP8L, SCD1, and CD133, 1:100 dilution) at 4 °C overnight. After incubation with the secondary antibody for 1h, DAB was added. The immunostaining images were captured using an Olympus microscope, mean optical density (MOD) values for each specimen were measured by Image-pro plus software.
Immunoflurescense(IF) and TUNEL staining
The paraffin-embedded slices were eparaffinized and washed with PBS, followed by permeabilization with 0.3% Triton X-100 for 30 min at RT. The
coverslips were blocked with 5% BSA and incubated with anti-Ki67(1:200,ab16667, Abcam) at 4 °C overnight. or terminal deoxynucleotidyl transferase (TdT) in reaction buffer (containing a fixed concentration of digoxigenin-labelled nucleotides, TUNEL, AF594) at 37 °C for 1h. Subsequently, the cells were incubated with fluorescence-conjugated secondary antibodies for 1 h. Then, the nuclei were stained with DAPI(Sigma). The stained cells were observed with a fluorescence microscope (Olympus, Japan).
Bioinformatics
The correlation between the expression of AKAP8L and SCD1 was analyzed by TCGA Tumor from GEPIA Databases. BLAST was used to predict the potential binding sites between AKAP8L and SCD1 mRNA. Furthermore, the expression of AKAP8L and SCD1 and their prognosis roles in gastric cancer were confirmed by Kaplan-Meier plotter analysis.
Statistical analysis
Sample sizes were denoted in the figure legends. All experiments were performed in triplicate. Samples included in the analyses surely met proper experimental conditions. Results were quantified as mean ± SEM. All statistical analyses were conducted with SPSS v20.0 software (Abbott Laboratories, USA) and GraphPad Prism software 6.0 (GraphPad Software, USA), and performed using the Student’s t test. Kaplan-Meier plotter analysis were used to estimate the prognostic relevance of AKAP8L and SCD1 in univariate analysis. Two-tailed Spearman’s correlation analysis was used to analyze the associations between AKAP8L and SCD1 mRNA expression. P < 0.05 was considered statistically significant.