Animals and Groups
This experiment was approved by the Animal Experiments Ethics Committee of the Associated Hospital of Beihua University (Ethical approval number: Protocol Number 2017-08-16). Animal care was in accordance with the Animal Research: Reporting in Vivo Experiments guidelines. The study was conducted on 60 skeletally mature New Zealand rabbits (23-weeks-old) weighing between 2.5-3.0 kg. All healthy SPF-grade male animals were obtained from the Experimental Animal Breeding and Research Centre, Bethune Medical College Animal Experimental Center, Jilin University (No.: SCXK-2018-0006). Based on previous experience, the animals were randomly assigned into three groups using a random contrast method and random number tables including a experimental group, sham group (n=6) and and a blank control group (n=6). The experimental group is composed of an anteromedial bundle (AMB) rupture group (n=24), a posterolateral bundle (PLB) rupture group (n=24).
Plan-operative procedure
Rabbits in the model group were subjected to right hind limbs knee surgery to induce ACL part injury under the arthroscopy (Andover, MA, USA; 72200616) as previously described [2, 10]. In a brief, the rabbits were fixed in a supine position on the operation table with the 4 cm × 4 cm surgical area shaved. Anesthesia was administered intramuscularly at dosages of ketamine (100 mg/kg), disinfected with complexed iodine, draped a sterile surgical towel. An adequate opening was built with 0.5-cm long incisions through the anterior medial and lateral approach into the joint cavity. The operator explored the intact structures of articular cartilage and meniscus. While completely bleeding was stopped and fixed the knee at 0 °, the ACL was fully exposed. In AMB rupture group, a special blunt hook was used to hold the tension fibers in the middle and lower in 1/2 of the ACL, and then cut off the bundle. In PLB rupture group, firstly, flex the knee to 90, application of the special hook is to hold the loose fiber bundle in the middle and lower 1/2 of ACL, afterwards, cut off the fiber bundle while the knee joint is straightened. In the sham operation group, the same procedure as the medial incision of the knee into the joint cavity was exposed without cutting off the ACL. The Anterior drawer test confirmed that the model of ACL rupture had been successfully created while the incision was then sutured with 3/0 absorbable sutures. Four days after surgery, all postoperative rabbits were intramuscularly injected with 400,000 U penicillin to prevent infection. In a blank group, the rabbit legs did not make any interventions with normal feeding. All rabbits were housed with sub-cage feeding. The cage size was 60 cm×60 cm×40 cm with a temperature of 23-25 ℃and a relative humidity of 55%.
Gross observations of animal statuses and meniscus
Animal body weight was measured, and wound conditions as well as gait were observed and recorded daily. For joint function scores, the knees behavioral scores of the three groups of animals were scored according to the absence of passive movement of the knee, the degree of lameness and the stability of the anterior drawer test, with a minimum score of 0 and a maximum score of 9 at 2nd, 4th and 8th weeks after surgery with a reference to Sun et al [11]. Six rabbits were randomly sacrificed in the experimental group at the 2nd, 4th and 8th weeks after the operation. And, 2 rabbits in the controls were performed as the experimental group. The knee was experimentally dissected and the typical meniscus shapes were observed along with other properties including fractures, color, and surface smoothness.
Histopathological and immunohistochemistry evaluation
The posterior angles of the medial meniscus in the three groups were cut separately and the surrounding tissue was thoroughly removed. 0.9% sodium chloride brine was rinsed and fixed for 24 hours. The histological section of the operational side of the meniscus was stained with haematoxylin-eosin. Histological changes in the meniscus tissue were measured according to the method as previously described [10].
Immunohistochemical staining using antibodies directly against MMP-13 was adopted with the Histostain-SP kit (Zymed, San Francisco, CA). The tissue sections were incubated with a specific antibody against MMP-13 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) (1:500). Normal goat IgG (1:300) was used as a negative control. The expression of MMP-13 was detected by a biotin-streptavidin-peroxidase system using diaminobenzidine as a chromogen. Counterstaining was carried out with hematoxylin.
Cytological measurement of knee joint fluid samples
Primary outcomes included levels of IL-1β and IL-17 in the knee joint fluid. For each operative animal, a minimum of 1 ml of synovial fluid was aspirated from the knee joint prior to orthopedic surgery via direct needle aspiration. Samples were placed in a BD Vacutainer test tube and centrifuged at 3,000 rpm for 10 minutes. The supernatant was stored at 20 ℃ until the assay. The levels of IL-1β and IL-17 were measured by means of an enzyme-linked immunosorbant assay (ELISA) with the Quantikine® HS Human IL-1β and IL-17 Immunoassay kit (R&D Systems, MN, USA). The limit of detection was lower than 2 pg/mL for IL-1β, IL-17, and the intra-batch CV and inter-batch CV were < 9 % and <15 % respectively.
RNA isolation and analysis of the mRNA expressions of MMP-13
0.1g of fresh meniscus tissue was cut into a foam with scissors. The pellets were collected and total RNA was extracted with TRIzol reagent (Invitrogen, Carlsbad, CA, USA). cDNA was synthesized with a cDNA synthesis kit (Bio-Rad, Hercules, CA, USA) according to the manufacturer’s instructions. The primer sequences are as follows: MMP-13 forward TGACCACTCCAAGGACCCAG; reverse GAGGATGCAGACGCCCAGAAGA. G3PDH forward CCACTTTGTGAAGCTCATTTCCT; reverse TCGTCCTCCTCTGGTGCTCT.
qRT-PCR analysis of the mRNA was performed using a standard kit (Invitrogen, Carlsbad, CA, USA). The relative transcript levels of the target genes were normalized to that of G3PDH using the 2-∆∆Ct assay. Relative levels of gene expression are presented as the mean ± standard deviation of three independent experiments.
Statistical analysis
Statistical analysis was performed with SPSS version 10.0 (SPSS, Inc., Chicago, IL, USA) and data are expressed as the mean ± standard deviation. Normality of data distribution was assessed by the Jarque-Bera test. When the cytokine concentrations were non-Gaussian distribution, both t-test and Mann–Whitney–Wilcoxon (MWW) tests were utilized. Analysis of variance (one-way ANOVA) and post hoc Bonferroni multiple comparisons test was utilized to compare differences between groups. A value of P<0.05 was considered statistically significant.