Materials
bovine serum albumin (BSA), oil red O, fetal bovine serum (FBS) and Dulbecco's modified Eagle's medium (DMEM) culture medium were provided by Gibco (Grand Island, USA). OCT compound was from Tissue Tek (Sakura, CA). Lipopolysaccharide (LPS) was from Sigma-Aldrich (St Louis, USA).
Preparation and compositional analysis of SWZ-4
According to previous methods, SWZ-4 were prepared in our lab [10, 12]. Briefly, crude polysaccharides (SWZ) was extracted and underwent anion exchange chromatography. Dialysis, concentration and precipitation were then performed through ethanol. The autohydrolysis and compositional analysis of SWZ-4 was performed according to our previous study [12, 13].
Animal experiments
All animal studies were approved by the Ethics Committee of the Zhejiang Academy of Medical Sciences (License SYXK 2019–0011). The ApoE KO mice were randomly divided into 4 groups (n = 10): control group (NC group), high-fat diet with low-dose SWZ-4 (L-SWZ-4 group), high-fat diet with high-dose SWZ-4 (H-SWZ-4 group) and high-fat diet alone (model group). After more than a week of adaptive feeding, forty male 6-week-old ApoE KO mice were fed with high-fat diet (HFD) containing 21% fat and 0.2% cholesterol or normal chow diet for 16 weeks. All mice were kept in a SPF mouse facility and injected intraperitoneally with SWZ-4 or vehicle (saline) for a total of 16 weeks, mice in the L-SWZ-4 and H-SWZ-4 groups were received 50mg/kg and 100mg/kg SWZ-4 every two days. Body weight was measured once per 4 weeks. Before blood sampling and tissue collection, all the mice were euthanized with a lethal dose of xylazine hydrochloride (10 mg/kg).
Cell culture
The murine macrophage cell line RAW264.7 was obtained from the Cell Bank of Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences (Shanghai, China), and cultured in DMEM supplemented with 10% FBS and 1% penicillin streptomycin at 37°C in humidified 5% CO2 incubators. In the NC group, cells were treated only in serum-free DMEM. After pretreatment with DMSO or SWZ-4 (0.4 or 0.8mg/ml) for 1 h, the LPS group (DMSO + LPS) and SWZ-4 group (SWZ-4 + LPS) cells were stimulated with LPS (1 µg/ml) for 24 h under serum-starved culture conditions. All cell experiments were performed at least three times in triplicate.
Cell viability assay
Cell viability was measured using a Cell Counting Kit-8 (CCK-8, Tianjing Biolite Biotech, China) assay. Briefly, RAW 264.7 cells were seeded into 96-well culture plates and incubated with various concentrations of SWZ-4 (0.4, 0.8 or 1.0 mg/ml) with or without LPS (1 µg/ml). After 24h, CCK-8 reagent was added to each well and incubated for 3 h in incubator. The absorbance values were detected at a wavelength of 450 nm.
Measurement of serum lipid profile and inflammatory cytokines
Commercial kits (Nanjing Jiancheng Bioengineering Institute, China) were employed to evaluate serum lipid profile (triglycerides [TG], total cholesterol [TC], high density lipoprotein cholesterol [HDL-C] and low density lipoprotein cholesterol [LDL-C]) in ApoE KO mice. Serum inflammatory cytokine levels of TNF-α, IL-1, and IL-6 in the ApoE KO mice and RAW264.7 cells were determined by enzyme-linked immunosorbent assay (ELISA) kits (Elabscience, China). All procedures were performed strictly according to the manufacturer’s instructions.
Assessment of atherosclerosis with Sudan IV and Oil Red O staining
The dissected aorta from the root to the abdominal region was embedded in paraffin or frozen in Tissue-Tek OCT media. Serial 4 mm sections of the aortic valve were cut and stained with Oil Red O. Aortas were cut longitudinally and stained with Sudan IV solution. Two observers measured and quantified the total surface area and the total Oil Red O-positive lesion area using Image-Pro Plus 6.0. The degree of atherosclerotic lesion was evaluated by the percentage of lesion in the total area.
Quantitative real-time PCR analysis
mRNA expression levels were analyzed by quantitative Real-time PCR (qRT-PCR) analysis using specific primers (Table 1). Briefly, total RNA was isolated by Trizol Reagent (Invitrogen, USA) and reverse transcribed into cDNA by SuperScriptTM III Reverse Transcriptase (Invitrogen, USA). The expression of GAPDH was used as an internal control. Gene expression levels were calculated using the delta-Ct method. Each sample was assayed in triplicate.
Table 1
Primer sequences for real-time RT-PCR
Gene | Accession no. | Sequence(5’3’) | Size(bp) |
GAPDH | NC_000072.7 | F:GGGGTCCCAGCTTAGGTTCA | 100 |
| | R: CCAATACGGCCAAATCCGTTC | |
TLR4 | NC_000070.7 | F: TCCCTGCATAGAGGTAGTTCC | 119 |
| | R: TCAAGGGGTTGAAGCTCAGA | |
MyD88 | NC_000075.7 | F: AGGACAAACGCCGGAACTTT | 196 |
| | R: CATGCGGCGACACCTTTTCT | |
IκBα | NC_000078.7 | F: GCCAGCTGACCCTGGAAAAT | 103 |
| | R: TCATCATAGGGCAGCTCATCC | |
p65(Rela) | NC_000085.7 | F:CACCCCACCATCAAGATCAA | 175 |
| | R:CTCTATAGGAACTATGGATACTGCG | |
IL-6 | NC_000071.7 | F: TTCCTCTGGTCTTCTGGAGT | 148 |
| | R: TCTGTGACTCCAGCTTATCTCTTG | |
TNF-α | NC_000083.7 | F: ACCCTCACACTCACAAACCAC | 134 |
| | R: ACAAGGTACAACCCATCGGC | |
Western blotting analysis
Protein samples from mice aortas tissue and RAW264.7 cells were harvested and homogenized with SDS buffer. Samples were placed on ice for 30 min and centrifugated at 12,000g for 10min at 4°C, and then the supernatant was collected. Total proteins were denatured by boiling at 100°C for 10 min in 5 X loading buffer containing SDS. Protein samples were subjected to SDS-PAGE electrophoresis and then transferred onto nitrocellulose membrane. After blocking, the blots were incubated at 4°C overnight with primary antibody TLR-4 (1:1000,ab13556,abcam,UK), MyD88 (1:1000,ab219413,abcam,UK), p-IκBα (1:1000,2859S,CST,USA), IκBα (1:1000,4814S,CST,USA), p-p65 (1:1000,3033S,CST,USA), p65 (1:1000,8242S,CST,USA) and GAPDH (1:2000, Vazyme, Nanjing, Jiangsu, China). The corresponding HRP-conjugated secondary antibodies were added for 2 h. Protein bands were visualized using enhanced chemiluminescence detection reagents. Relative changes in protein expression were quantified using Image J. All western blot procedures were performed at least three times.
Statistical analysis
Data are expressed as the mean ± standard deviation (S.D.). The significant differences between groups were assessed by one-way analysis of variance followed by LSD method for multiple comparisons. All tests were conducted using SPSS 13.0. All significance was considered at P < 0.05.