Establishment and characterization of a new fibroblast-like cell line from the skin of a vertebrate model, zebrafish (Danio rerio)

doi:10.21203/rs.3.rs-1890769/v1

Download PDF

Research Article

Establishment and characterization of a new fibroblast-like cell line from the skin of a vertebrate model, zebrafish (Danio rerio)

https://doi.org/10.21203/rs.3.rs-1890769/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

A novel cell line designated as DRS (Danio rerio skin) was established and characterized from the skin tissue of wild-type zebrafish, Danio rerio, by the explant technique. The cells thrived well in the Leibovitz’s -15 medium supplemented with 15% FBS and routinely passaged at regular intervals. The DRS cells mainly feature fibroblast-like morphology. The culture conditions of the cells were determined by incubating the cells at varying concentrations of FBS and temperature; the optimum was 15% FBS and 28°C, respectively. Cells were cryopreserved and revived with 70–75% viability at different passage levels. Two extracellular products from bacterial species Aeromonas hydrophila and Edwardsiella tarda were tested and found toxic to the DRS cells. Mitochondrial genes, namely COI and 16S rRNA PCR amplification and partial sequencing authenticated the species of origin of cells. The modal diploid (2n) chromosome number of the cells was 50. The cells were transfected with pmaxGFP plasmid tested positive for green fluorescence at 24–48 h post-transfection, confirming the usefulness of the developed cell line for various in vitro applications.

General Cell Biology & Physiology

Molecular Biology

Molecular Genetics

Danio rerio

skin

cell line

bacterial extracellular products

mycoplasma

transfection

As a vital vertebrate model, zebrafish have advanced in developmental biology, toxicology, and neurobiology [14]. It is mainly because of the fully sequenced, annotated genome, transparent embryos, and the possibility to compare mutants with well-characterized wild-type individuals [3]. It has a high fecundity rate and can develop embryos rapidly ex-utero in less than a week to develop organ systems [8]. The cell lines established from the zebrafish facilitate the correlation of the health-relevant issues of humans. The foremost reason is mainly due to the evolutionary history of conserved gene sequences of zebrafish compared to the human genome to a larger degree, i.e., genetic similarities [17]. Thus, zebrafish form a most promising vertebrate animal model for biomedical applications such as human disease, drug screening, wound healing, and cancer research.

The development of cell lines from zebrafish began in the early 1990s. The majority of the zebrafish cell lines available to the scientific community for in-vitro approaches mainly originated from embryonic tissue and featured fibroblast-like morphology. The first report of tissue-specific cell lines (ZPF) and embryonic cell line (ZEM) featuring fibroblast morphology were derived from the fin tissue and mid-blastula, respectively [11]. Most in vitro research on zebrafish has been intensively carried out in the liver tissue-specific epithelial cell line ZFL [18]. Over the decades, very few tissue-specific cell lines, viz., ZSSJ (spleen), DrRPE (retinal pigment), DRM (muscle), DrG (Gills), DrF (caudal fin), and DRCF (caudal fin) [54, 32, 25, 33, 31] respectively have been reported from the genetically important model animal. The tissue-specific cell lines from zebrafish find their applications limited to wound healing, ultraviolet radiation biology, contaminants toxicity, and gene expression studies. Although zebrafish is a vital model organism, it lacks other in vitro experimental approaches due to the unavailability of suitable cell culture systems [18]. To exploit various in vitro research applications, establishing novel tissue-specific cell lines of higher genetic importance is foremost. Hence, we aimed to develop a tissue-specific cell line from the model zebrafish D. rerio targeting other in vitro research approaches.

Fish skin plays a significant role in the first-line defence system that aids in conferring long-term immunity against the microbes in the aquatic habitat and several other peptide hormones involved in several physiological processes [37]. It serves as a physical barrier by the secretion of enzymes, immunoglobulins, mucins, lectins, and other microbial peptides [5]. The cell lines from the integument system could be employed to understand the mechanisms underlying physiology and wound healing [44]. The susceptibility of zebrafish skin cells to the invading viruses could help study the viral pathogenicity. Moreover, it provides insights into skin antiviral response for elucidating the mechanism of mucosal immunity [28]. The transcriptome profiling of skin cells helps understand the mechanism of the host immune responses against bacterial pathogens, thereby allowing the study of differential gene expression [29].

Further, zebrafish skin also possesses a higher regeneration capacity similar to other organs such as fins, heart, and optic nerve [53]. Therefore, cell lines established from the skin tissue could be applicable in regenerative medicine for producing fish skin grafts [45] and the cytotoxicity assessment of silica nanoparticles [9]. Zebrafish skin also offers a relevant biological model to study pigment research [12]. However, to our knowledge, there is no report on the skin cell line from the wild-type zebrafish. Therefore, we aimed to develop and characterize the cell culture system from the skin tissue of the model organism D. rerio by the explant technique and its outcome towards the healthy cell line designated as DRS (Danio rerio skin).

2.1 Ethical Approval

Institutional Animal Ethics Committee (IAEC) and Board of Studies (BoS), Fish Genetics and Biotechnology Division, ICAR-Central Institute of Fisheries Education, Mumbai, approved all experimental protocols involved in this study. The methodologies involved in the study were carried out following relevant institutional guidelines and regulations.

2.2 Experiment animal

A total of 40 healthy wild type fingerlings of Danio rerio weighing 2 g and 1.5 cm in length (approximately) were procured from the local aquarium (Mumbai, Maharashtra) and maintained at room temperature in a well-aerated and conditioned water. Donor fish (D. rerio) was starved in aerated water for 24 h then sacrificed by euthanization using ice-cold water containing 1000 IU/ml of penicillin, 1000 μg/ml of streptomycin, 25 μg of amphotericin B and dipped in 5% sodium hypochlorite for 5 minutes, followed by surface sterilization with 70% alcohol and operated in vivo. Antibiotics were used only during the explant preparation, and the cultures progressed devoid of antibiotics later.

2.3 Initiation of Primary cultures

The method followed to initiate the primary culture was similar to that described for the PHG cell line [40] with some minor modifications. Target skin tissue from three fish was aseptically dissected out by removing the scales, pooled, and washed several times with DPBS (Dulbecco’s phosphate-buffered saline) (Hi-media, India) containing 500 IU/ml penicillin, 500 µg/ml streptomycin, and 2.5 µg amphotericin-B (Hi-Media, India). The tissues were aseptically minced into small explants of size 1mm³ seeded into 25 cm² cell culture flasks (Hi-Media, India). Adherence of explants was accomplished by adding 0.2ml of fetal bovine serum (FBS) (Gibco, USA). Then, the flasks were incubated overnight to allow the explant tissues to attach at 28°C based on the acclimatization temperature of the fish [7]. After allowing the tissue to attach, 4 ml of Leibovitz-15 medium (Hi-Media, India) supplemented with 20% FBS was added. One-fourth of the medium was removed and added with fresh medium every 3-4 days. Cell proliferation from the adhered explants and contamination of flasks were observed regularly using an inverted microscope (Nikon, Japan).

2.4 Subculture of monolayers

The primary cultures, upon reaching 80-90% confluency, the cells were harvested using Trypsin-EDTA solution (0.25% trypsin) (HiMedia, India) and 0.2% ethylenediaminetetraacetic acid (EDTA) without dislodging the explants. The detached cells were seeded in a split ratio of 1:2 into 25cm² flasks adding fresh 4 ml of L-15 medium containing 20% FBS. Then the flasks were incubated at 28 °C.

2.5 Cryopreservation

The protocol described by [2] for cryopreservation of cells was followed with minor modifications. Briefly, DRS cells at different passage levels 3,13, 28, and 33 were harvested by trypsinization and followed by centrifugation at 125×g for 5 minutes. The pelleted cells at a 1× 10⁶/ml density were suspended in L-15 medium containing 10% DMSO and 40% FBS. The cell suspension approximately 1.0 ml was transferred into 2 ml cryovials. Then the cryovials were placed in a freeze control (Mr. Frost) and incubated serially at 4° C for 1 h, -20° C for 2 h, -80° C overnight, and then finally transferred into liquid nitrogen (-196° C). For the revival, cryovials containing DRS cells were thawed in a water bath for 2 mins at 28°C and centrifuged at 125×g for 7 min. After removing the freezing medium, the cells were suspended in L-15 medium containing 10% FBS and were analyzed for cell viability using a TC-20 automated cell counter (Bio-Rad, USA).

2.6 Growth pattern

The optimum temperature for the growth of the DRS cells at passage 17^th was determined by incubating the flasks in a BOD incubator (Labtro, India) at varying temperatures ranging from 20, 24, 28, and 32˚C over seven days at a seeding concentration of 1x10⁵cells in 25 cm² culture flasks in triplicates. Then, three flasks from each temperature at which they were incubated were trypsinized, and cell counting was performed using a TC-20 automated cell counter (Bio-Rad, USA) for seven consecutive days on an alternate day. Similar procedures were performed for the effects of varying concentrations of FBS (10, 15, and 20 %) on cell growth at 28˚C over seven days.

2.7 Cell Plating Efficiency

The DRS cells at passage 12th were seeded at 200, 500, and 1000 cells/ml in triplicates to determine the plating efficiency. After incubation for ten days, the spent medium was removed, and the cells were fixed with 5 ml of 1% crystal violet in 25% formalin stain fixative solution for 15 min, rinsed with tap water, and air-dried. Then, the cell colonies were counted under an inverted microscope, and plating efficiency was calculated using the formula described by [16]. Plating efficiency (Y) = (x/z) × 100, Where x= number of colonies counted, z= seeding density of the flask.

2.8 Cell Doubling time

The time interval required for a cell population to double in the middle of the logarithmic phase. The population doubling time of the DRS cell line was calculated at the 11^th passage using the formula. Cells population doubling time (DT) = T ln (Xe/Xb) where T= is the incubation time in any unit, Xe = cell number at the end of the incubation time, Xb= cell number beginning the incubation time [16].

2.9 Species authentication by PCR amplification

Template DNA from the DRS cell line at the 10^th passage and the skin tissue of D. rerio were isolated following [39] with minor modifications. The origin of the DRS cell line was authenticated by amplification of mitochondrial gene regions such as COI (Cytochrome C oxidase subunit I) and 16S rRNA of D. rerio using universal pair of primers, FishF1 and FishR1 [50] and 16sf1F140 and 16sf1R1524 [55] respectively. The primers sequences, PCR master mix composition, and the thermal regime for the COI and 16S rRNA gene amplification are mentioned in Table.1,2,3,4, respectively. The amplified products were analyzed using 1.0 % agarose gel containing ethidium bromide and visualized using gel documentation (BioRad). The amplified products were purified and subjected to sequencing by the external sequencing facility (Xcelris, Pvt. Ltd). The resultant sequences were aligned and compared to the known sequence of the species in the NCBI GenBank reference database (standard database ‘nr/nt’) using the Basic Local Alignment Search Tool (BLAST).

2.10 Chromosome analysis

Cells with 80% confluency at passages 16and 21 were used for chromosome preparations following [22] with some modifications. Briefly, the cells were incubated at 28°C in a complete growth medium containing 0.04 % of colchicine for 4 hrs. The cells, after incubation, were trypsinized and pelleted by centrifugation at 367g for 10 mins. The supernatant was removed, and cells were treated with 5ml of hypotonic solution KCl 0.07M for 25-30 mins. Then the cells were prefixed with 2ml of freshly prepared Carnoy’s fixative (3:1) (methanol: glacial acetic acid) for 5 mins. Again, the cell suspension was centrifuged at 367g for 10 mins, followed by washing the pellets with ice-cold Carnoy’s fixative twice. The pellets were resuspended in 0.5ml of fixative solution and dropped onto a clean glass slide using the conventional drop splash technique. Finally, glass slides were air-dried, stained with 5% Giemsa for 20-30 mins, and observed under light microscope (Nikon, USA) at 100X magnification. A total of 100 metaphase spreads were counted for chromosome analysis.

2.11 Transgene Expression

DRS cells at the 17^th passage were seeded into a six-well plate at a density of 1 x 10⁵cells/well and incubated overnight at 28˚C. Transfection was carried out using pmaxGFP plasmid DNA concentration of 400ng and reagent Lipofectamine 3000 (Invitrogen, USA) following the manufacturer’s protocol. The transfected cells were incubated overnight at 28⁰ C in the BODincubator. Then the spent medium was replaced with a fresh medium after 4-6 hours and tested for transgene expression. The number of cells positive for the green fluorescence was counted using ImageJ software (https://wsr.imagej.net/distros/win/ij153-win-java8.zip). The transfection efficiency was calculated based on the ratio of cells positive to the fluorescence and the total number of cells in 20 independent light fields [52].

2.12 Bacterial extracellular products (ECP’s) testing

For bacterial extracellular products (ECP’s) testing, two bacterial species, Aeromonas hydrophila and Edwardsiella tarda, were isolated from the diseased animal. The extracellular products were obtained by following the protocol described by [6] with some minor modifications. Briefly, the bacterial cells were incubated at 28°C for 48 h after spreading onto a cellophane sheet overlaying an agar plate. The cells were harvested by centrifugation at 13,000×g for 20 min at 4°C, and the supernatant was filtered through a 0.22-μm filter to get bacterial ECP’s as well as heat-killed bacteria and stored at -80° C until further use. The protein concentration of the isolated ECP’s was estimated by the BCA™ (Bicinchoninic acid) protein assay using Nanodrop™ (USA). The DRS monolayer was inoculated with 0.1ml of 10-fold serial dilutions of bacterial ECP’s and heat-killed bacteria. Wells inoculated with saline solution (0.85%) were treated as negative controls. The plates were incubated at 28°C, and the effect of ECP’s and heat-killed bacteria on the monolayers was observed after 24 and 48 h.

2.13 Mycoplasma detection

Mycoplasma presence in the DRS live cells and culture medium was tested at the 15^th passage using MycoFluor™ Mycoplasma Detection Kit (Invitrogen, USA), following the manufacturer’s instructions with minor modifications. Briefly, 1 volume of 20X concentrated MycoFluor reagent was added to 9 volumes of DRS cell suspension (1×10⁵cells/ml) incubated at RT for 10 min and observed using a near-ultraviolet fluorescence filter (excitation at 365 nm) (Nikon, USA).

3.1 Explant technique and subcultures

The explant primary culture technique initiated the monolayer of cells from the skin tissue of zebrafish, and routine subculture led to the development of the cell line designated as DRS (Danio rerio Skin). The cells started to proliferate from the explant tissue after five days of explant preparation, and a confluent monolayer was noticed on the 20^th day. The cells were initially grown in L-15 medium supplemented with 20% FBS, then reduced to 15% after the 12^th passage level. Initial subcultures were slow-growing and started to proliferate rapidly after the fifth passage. Thereon, the cells were routinely maintained and passaged at a ratio of 1:2 at 3-4 days intervals. The morphology of the primary cells was composed of epithelioid and fibroblastic during the initial cultures (Fig.1). Later, the fibroblastic morphology predominated after the 18^th passage. The cell line has been passaged for over 36 subcultures since its initiation in March 2022.

3.2 Cryopreservation

DRS skin cells at different passage levels 3,13, 18, 28, and 33 were stored in liquid nitrogen (-196°C) for over two months. The skin cells were recovered by thawing and seeded to form a confluent monolayer about 7 days after plating without showing any changes in the morphology. The average viability of the DRS was estimated to be 70-75% approximately.

3.3 Growth pattern

DRS cells could grow well in optimum conditions of 24 to 32°C. However, the highest growth rate was observed at 28°C (Fig.2A). i.e., the temperature required for the acclimatization condition of the fish. The growth of the cells increased from 10% to 20% FBS concentration and significantly better growth was observed at 15%, but the highest growth was observed at 20%. (Fig.2B)

3.4 Cell plating efficiency

The cells were seeded at a density of 200, 500, and 1000 cells/ flasks calculated plating efficiency of the DRS at the 12th passage level was 17, 25, and 41%, respectively, with no significant differences between replicates.

3.5 Cell doubling time

The calculated doubling time of the DRS cells was found to be 31h at passage level 11^th.

3.6 Species authentication by mitochondrial gene analysis

Mitochondrial gene analysis, namely COI and 16S rRNA, revealed the species of origin of the DRS cells was from zebrafish D. rerio. The PCR amplification of COI and 16S rRNA genes yielded the expected PCR products of size 655 bp and 1380 bp, respectively (Fig.3 & Fig.4). The subsequent comparative analysis of the aligned sequences with the known voucher specimen from D. rerio demonstrated 96-97% sequence similarity. The sequences have been submitted to the NCBI database for their accession number.

3.7 Chromosome analysis

The cells at passage levels 16 and 21 were arrested at metaphase using colchicine at a final concentration of 0.04% (Fig.5A). The result of counting a total of 100 metaphase spreads revealed that the diploid chromosome (2n) number ranged from 36 to 63 (Fig.5B). However, most cells were observed with a diploid chromosome number (2n=50).

3.8 Transgene expression

The DRS cell line at the 17^th passage was successfully transfected with the pmaxGFP vector under the control of the CMV promoter, resulting in stable transfection with a green fluorescence signal as early as 24 hpt (hours post-transfection) (Fig.6). The transfection efficiency of the DRS cells calculated was 7% approximately. The result suggests that the developed cell line has the potential to be applied in transgenic studies.

3.9 Bacterial Extracellular Products testing

Two bacterial strains, A. hydrophila and E. tarda, proved cytotoxic to the DRS cells at a concentration of 1/10 dilutions of bacterial ECP’s. No cytotoxicity was observed in cells exposed to heat-killed bacteria. The morphological changes of the cells after exposure to the bacterial ECP’s observed after 12h were rounding, shrinking. The partial detachment of cells was noticed after 24h of inoculation (Fig.7). The destruction of the confluent monolayer was observed after 48 h, and no significant changes were observed compared to the PBS-treated control group.

3.10 Mycoplasma detection

The developed cell line was free from mycoplasma contamination as no stained nuclei associated with the DRS cells were observed.

Most of the zebrafish cell lines have been established either from the embryonic stages or mutant strains such as AB and SJD types [22]. The cell lines reported from the wild-type zebrafish are very much limited that include DRCF [31]; DrG (Danio rerio Gill), DrRPE (Danio rerio Retinal Pigmented Epithelium) [32,33]; DRM (Danio rerio muscle) [25] and DrF (Danio rerio Fin) [22]. To our knowledge, this is the first report on the skin cell line from the wild-type zebrafish.

The explant method of primary culture offers the advantage of aiding the tissues to proliferate into a large number of cell types and reducing stress in culture conditions [47]. It also has the potential to aid the cell’s survival, attachment, and differentiation into another type by releasing the necessary growth factors [21]. The most attractive characteristic of the explant technique is that it does not affect the biological characteristics of the cells [27], unlike the enzymatic digestion method. As mentioned earlier, the previous reports of cell lines from the zebrafish, namely DrF, DrG, and DRCF, were successfully developed by the explant technique. Therefore, the explant technique is a suitable method to develop cell lines from zebrafish. The cell line established in this study is also in accordance with previous reports of zebrafish cell lines.

The developed cell line was grown in L-15 medium supplemented with 15% FBS. The morphology of the DRS cells was observed with a heterogeneous population of cells during the initial passages. Such co-existence of heterogeneous cell types during the initial phases was observed with morphological change into a single type, i.e., fibroblast, as the culture progressed after passage 18^th.Such morphological change of one cell type over the other has been reported commonly in many established cell lines [56.10, 43].

To avoid loss of cells by contamination or to reduce the genetic or phenotypic changes during the routine subcultures using a high volume of trypsin [43], cryopreservation of cultured cells is the best and also suitable method for the long-term preservation of cells [27]. Cryopreservation at different passage levels followed by the revival after two months of cryo-storage, the DRS cells were successfully recovered with a viability of 70-75% approximately, forming a confluent monolayer of cells after 7 days of plating, which indicates that the cryo-storage is not detrimental to the cells. No changes in the indicators of the functionality of cells, including morphology, attachment, and growth [30], were observed after recovery, which is in agreement with the earlier reports [32,45].

The precise in vitro culture conditions such as temperature, growth medium, nutritional supplements including FBS, and growth factors are vital for normal cellular activities. The growth condition of the cell line was studied by incubating the cells at varied temperatures and FBS serum levels. The outset growth temperature for the DRS cells was 28°C, where the cells thrived well based on the acclimatization temperature of the fish. The cells proliferated in large numbers in L-15 medium supplemented with 20% FBS during the initial cultures. But, considering the cost-effectiveness of the culture period, the cell line was maintained optimally at 15% FBS, which is also in conformity with other established cell lines from the zebrafish DRM [25] and DrF [22].

DRS at passage level 12^th was seeded with a cell density of 1×10³cells/ml, resulting in the highest plating efficiency of 41%, and there was no significant difference between the replicates. In contrast, the cells seeded at low density resulted in relatively lower efficiency. Similar findings have been reported in various cell lines, such as HCF cells [1] and PHG cells [40]. Such reduced plating efficiency of cells seeded at lower density is mainly due to the non-linear correlation between the seeding density and the plating efficiency [35]. However, higher seeding density could enhance the plating efficiency [42] or by using other conditioning medium [24].

The population doubling time of the developed DRS cells estimated was 31h at the 11^th passage. The correlation between the cell doubling time and FBS concentration at which the cells were grown resulted in increased population doubling, i.e., the higher the optimum level of FBS concentration, the higher the replicative lifespan of cells [56, 15].

Misidentification or cross-contamination of the cell lines is the major hindrance in cell culture systems intended for various in vitro applications. Hence, characterization of the cell line for its origin or any inter or intra-species cross-contamination using molecular approaches helps in studying the integrity of the cell line developed and also facilitates research accuracy [19]. Among the number of techniques for cell line authentication, PCR-based amplification of COI gene using sequence-specific primers was employed to identify the species origin of developed cell lines [34]. This study confirmed the origin of the DRS cells by COI and 16S rRNA gene amplification using universal pair of primers. Similarly, many cell lines have been characterized for their species identity by COI and 16S rRNA gene amplification routinely [1,13,43].

The distribution of the chromosomal numbers per cell is the crucial property of a cell population for both the performance and timeline of the cell line [49]. The commonly employed technique for measuring abnormalities in the chromosome number and the quality of the cell line is chromosome analysis [4]. The established cell line DRS cells exhibited a diploid (2n) chromosome number of 50 in the majority of the cells, which agrees with earlier reports from the zebrafish [22,31].

The ability of the cells to express the foreign genes determines the feasibility of the cell line in exogenous gene expression studies. In our study, the cell line was stably transfected with the plasmid DNA encoding green fluorescence protein with 7% transfection efficiency. Generally, higher transfection efficiency is needed only for the research targeting applications in biochemical studies or siRNA transfection [41]; however, the resulted transfection efficiency from this study is sufficient to study in vitro gene expression of various recombinant constructs.

Bacterial ECP’s A. hydrophila and E. tarda were toxic to the DRS cells. The primary role of the ECP’s secreted by bacterial pathogens is to counteract the host defence mechanism by increasing the virulence of the pathogen [36]. Previously, A. hydrophila and E. tarda have been reported to cause cytotoxic effects and invasion into the ZF4 cells, respectively [38, 57]. The in vitro bacterial ECP’s cytotoxicity of the DRS cells from this study is similar to the observations of established cell line PCF [20] and could be correlated with the in vivo acute toxicity of bacterial pathogens. Hence, in vitro approach of bacterial ECP testing could be an alternative tool for in vivo assays.

Mycoplasma prevalence has been estimated at more than 20% of in vitro cultures, possibly through contaminated culture reagents or poor aseptic techniques [48]. It usually evades visual inspection and persists in the culture for a prolonged period without severe characteristic changes in the cell. However, its presence significantly affects the culture by altering cellular parameters like cell growth, metabolism, chromosomal aberrations [51] and cell proliferation [23]. In this study, the fluorescent MycoFluor™ Mycoplasma detection kit was used to test the presence of mycoplasma. However, the fluorochrome did not stain the nuclei of the DRS cells associated with mycoplasma. Therefore, the cultures are considered to be free from mycoplasma contamination.

The DRS cell line was successfully developed from the skin of D. rerio. The cell line was further characterized by its growth parameters like temperature and FBS concentration. The other routine cellular parameters like cryopreservation, plating efficiency, and doubling time were calculated. The cell line was authenticated for its species of origin using mitochondrial genes such as COI, 16S rRNA, and chromosome analysis. The exogenous gene expression was confirmed by cells showing a positive signal to the green fluorescence. Testing the cell line using a mycoplasma detection kit revealed that the cell line is devoid of contamination. Two bacterial extracellular products (ECP’s) were tested and found toxic to the DRS cells. This is the first report on the skin cell line from the wild-type zebrafish that would contribute to the research community as a valuable in vitro tool.

Aarattuthodi S, Dharan V, Khoo L, Bosworth B. Establishment and characterization of a cell line from ictalurid catfish. Journal of the World Aquaculture Society. 2022.
Abdul NA, Seepoo AM, Gani T, Sugumar V, Selvam S, Allahbagash B, Abdul Kuthoos AN, Palsamy RK, Kishore M P, M. Rajwade J, Azeez SS. Development and characterization of five novel cell lines from snubnose pompano, Trachinotus blochii (Lacepede, 1801), and their application in gene expression and virological studies. Journal of Fish Diseases. 2022 Jan;45(1):121–39.
Ali S, Champagne DL, Spaink HP, Richardson MK. Zebrafish embryos and larvae: a new generation of disease models and drug screens. Birth Defects Research Part C: Embryo Today: Reviews. 2011 Jun;93(2):115–33.
Almeida JL, Cole KD, Plant AL. Standards for cell line authentication and beyond. PLoS biology. 2016 Jun 14;14(6):e1002476.
Ángeles Esteban M. An overview of the immunological defenses in fish skin. International scholarly research notices. 2012;2012.
Balebona MC, Morinigo MA, Borrego JJ. Role of extracellular products in the pathogenicity of Vibrio strains on cultured gilt-head seabream (Sparus aurata). Microbiologia (Madrid, Spain). 1995 Dec 1;11(4):439 – 46.
Bols NC, Lee LE. Technology and uses of cell cultures from the tissues and organs of bony fish. Cytotechnology. 1991 Jul;6(3):163–87.
Bootorabi F, Manouchehri H, Changizi R, Barker H, Palazzo E, Saltari A, Parikka M, Pincelli C, Aspatwar A. Zebrafish as a model organism for the development of drugs for skin cancer. International journal of molecular sciences. 2017 Jul 18;18(7):1550.
Chakraborty C, Sharma AR, Sharma G, Lee SS. Zebrafish: A complete animal model to enumerate the nanoparticle toxicity. Journal of nanobiotechnology. 2016 Dec;14(1):1–3.
Chen SL, Ren GC, Sha ZX, Hong Y. Development and characterization of a continuous embryonic cell line from turbot (Scophthalmus maximus). Aquaculture. 2005 Sep 12;249(1–4):63–8.
Collodi P, Kame Y, Ernst T, Miranda C, Buhler DR, Barnes DW. Culture of cells from zebrafish (Brachydanio rerio) embryo and adult tissues. Cell biology and toxicology. 1992 Mar;8(1):43–61.
Cooper CD. Insights from zebrafish on human pigment cell disease and treatment. Developmental dynamics. 2017 Nov;246(11):889–96.
Cooper JK, Sykes G, King S, Cottrill K, Ivanova NV, Hanner R, Ikonomi P. Species identification in cell culture: a two-pronged molecular approach. In Vitro Cellular & Developmental Biology-Animal. 2007 Dec;43(10):344–51.
De Esch C, Slieker R, Wolterbeek A, Woutersen R, de Groot D. Zebrafish as potential model for developmental neurotoxicity testing: a mini review. Neurotoxicology and teratology. 2012 Nov 1;34(6):545 – 53.
Duthu GS, Smith JR. In vitro proliferation and lifespan of bovine aorta endothelial cells: effect of culture conditions and fibroblast growth factor. Journal of Cellular Physiology. 1980 Jun;103(3):385–92.
Freshney RI. Culture of animal cells: a manual of basic technique and specialized applications. John Wiley & Sons; 2015 Dec 23.
Garcia, G.R., Noyes, P.D. and Tanguay, R.L., 2016. Advancements in zebrafish applications for 21st century toxicology. Pharmacology & therapeutics, 161, pp.11–21.
Ghosh C, Zhou YL, Collodi P. Derivation and characterization of a zebrafish liver cell line. Cell biology and toxicology. 1994 Jun;10(3):167–76.
Goswami M, Belathur Shambhugowda Y, Sathiyanarayanan A, Pinto N, Duscher A, Ovissipour R, Lakra WS, Chandragiri Nagarajarao R. Cellular Aquaculture: Prospects and Challenges. Micromachines. 2022 May 26;13(6):828.
Goswami M, Sharma BS, Yadav K, Bahuguna SN, Lakra WS. Establishment and characterization of a piscean PCF cell line for toxicity and gene expression studies as in vitro model. Tissue and Cell. 2014 Jun 1;46(3):206 – 12.
Hendijani F. Explant culture: An advantageous method for isolation of mesenchymal stem cells from human tissues. Cell proliferation. 2017 Apr;50(2):e12334.
Kalaiselvi Sivalingam NN, Seepoo AM, Gani T, Selvam S, Azeez Sait SH. Zebrafish fin-derived fibroblast cell line: A model for in vitro wound healing. Journal of fish diseases. 2019 Apr;42(4):573–84.
Kim BC, Kim SY, Kwon YD, Choe SC, Han DW, Hwang YS. Mycoplasma detection and elimination are necessary for the application of stem cell from human dental apical papilla to tissue engineering and regenerative medicine. Biomaterials research. 2015 Dec;19(1):1–9.
Komura JI, Mitani H, Shima A. Fish cell culture: Establishment of two fibroblast-like cell lines (OL-17 and OL-32) from fins of the medaka, Oryzias latipes. In vitro cellular & developmental biology. 1988 Apr;24(4):294-8.
Kumar A, Singh N, Goswami M, Srivastava JK, Mishra AK, Lakra WS. Establishment and characterization of a new muscle cell line of Zebrafish (Danio rerio) as an in vitro model for gene expression studies. Animal biotechnology. 2016 Jul 2;27(3):166 – 73.
Lei XY, Chen ZY, He LB, Pei C, Yuan XP, Zhang QY. Characterization and virus susceptibility of a skin cell line from red-spotted grouper (Epinephelus akaara). Fish physiology and biochemistry. 2012 Aug;38(4):1175–82.
Liu J, Liu X, Zeng Q, Wang B, Xiao K, Tan C, Du H. Establishment and characterization of a cell line derived from fin of the endangered Yangtze sturgeon (Acipenser dabryanus). In Vitro Cellular & Developmental Biology-Animal. 2020 Sep;56(8):650-8.
Liu R, Hu X, Lü A, Song Y, Lian Z, Sun J, Sung YY. Proteomic profiling of zebrafish challenged by spring viremia of carp virus provides insight into skin antiviral response. Zebrafish. 2020 Apr 1;17(2):91–103.
Lü AJ, Hu XC, Wang Y, Zhu AH, Shen LL, Tian J, Feng ZZ, Feng ZJ. Skin immune response in the zebrafish, Danio rerio (Hamilton), to Aeromonas hydrophila infection: a transcriptional profiling approach. Journal of Fish Diseases. 2015 Feb;38(2):137–50.
Mauger PE, Le Bail PY, Labbé C. Cryobanking of fish somatic cells: optimizations of fin explant culture and fin cell cryopreservation. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology. 2006 May 1;144(1):29–37.
Meena LL, Goswami M, Chaudhari A, Nagpure NS, Gireesh-Babu P, Dubey A, Das DK. Development and characterization of a new DRCF cell line from Indian wild strain zebrafish Danio rerio (Hamilton 1822). Fish physiology and biochemistry. 2020 Aug;46(4):1337–47.
Nambi KN, Majeed SA, Taju G, Sivasubbu S, Babu VS, Hameed AS. Effects of nicotine on zebrafish: A comparative response between a newly established gill cell line and whole gills. Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology. 2017;195:68–77.
Nambi KS, Abdul Majeed S, Taju G, Sivasubbu S, Sundar Raj N, Madan N, Sahul Hameed AS. Development and use of retinal pigmented epithelial cell line from zebrafish (Danio rerio) for evaluating the toxicity of ultraviolet-B. Zebrafish. 2015 Feb 1;12(1):21–32.
Parodi B, Aresu O, Bini D, Lorenzini R, Schena F, Visconti P, Cesaro M, Ferrera D, Andreotti V, Ruzzon T. Species identification and confirmation of human and animal cell lines: a PCR-based method. Biotechniques. 2002 Feb;32(2):432–40.
Pomp J, Wike JL, Ouwerkerk IJ, Hoogstraten C, Davelaar J, Schrier PI, Leer JW, Thames HD, Brock WA. Cell density dependent plating efficiency affects outcome and interpretation of colony forming assays. Radiotherapy and oncology. 1996 Aug 1;40(2):121-5.
Pridgeon JW, Klesius PH. Virulence of Aeromonas hydrophila to channel catfish Ictaluras punctatus fingerlings in the presence and absence of bacterial extracellular products. Diseases of aquatic organisms. 2011 Jul 12;95(3):209 – 15.
Rakers S, Gebert M, Uppalapati S, Meyer W, Maderson P, Sell AF, Kruse C, Paus R. ‘Fish matters’: the relevance of fish skin biology to investigative dermatology. Experimental dermatology. 2010 Apr;19(4):313–24.
Rodríguez I, Novoa B, Figueras A. Immune response of zebrafish (Danio rerio) against a newly isolated bacterial pathogen Aeromonas hydrophila. Fish & shellfish immunology. 2008 Sep 1;25(3):239 – 49.
Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. Cold spring harbor laboratory press; 1989.
Sathiyanarayanan A, Goswami M, Nagpure N, Babu P G, Das DK. Development and characterization of a new gill cell line from the striped catfish, Pangasianodon hypophthalmus (Sauvage, 1878). Fish Physiology and Biochemistry. 2022 Apr;48(2):367–80.
Schiøtz BL, Rosado EG, Baekkevold ES, Lukacs M, Mjaaland S, Sindre H, Grimholt U, Gjøen T. Enhanced transfection of cell lines from Atlantic salmon through nucoleofection and antibiotic selection. BMC Research Notes. 2011 Dec;4(1):1–7.
Sood N, Chaudhary DK, Pradhan PK, Verma DK, Swaminathan TR, Kushwaha B, Punia P, Jena JK. Establishment and characterization of a continuous cell line from thymus of striped snakehead, Channa striatus (Bloch 1793). In Vitro Cellular & Developmental Biology-Animal. 2015 Sep;51(8):787 – 96.
Swaminathan TR, Kumar R, Jency PM, Charan R, Syamkrishnan MU, Basheer VS, Sood N, Jena JK. A new fish cell line derived from the caudal fin of freshwater angelfish Pterophyllum scalare: development and characterization. Journal of fish biology. 2016 Sep;89(3):1769–81.
Takeo M, Lee W, Ito M. Wound healing and skin regeneration. Cold Spring Harbor perspectives in medicine. 2015 Jan 1;5(1):a023267.
Thangaraj RS, Narendrakumar L, Prasannan Geetha P, Shanmuganathan AR, Dharmaratnam A, Nithianantham SR. Comprehensive update on inventory of finfish cell lines developed during the last decade (2010–2020). Reviews in Aquaculture. 2021 Apr 30
Thangaraj RS, Ravi C, Kumar R, Dharmaratnam A, Saidmuhammed BV, Pradhan PK, Sood N. Derivation of two tilapia (Oreochromis niloticus) cell lines for efficient propagation of Tilapia Lake Virus (TiLV). Aquaculture. 2018 Jul 1;492:206–14.
Toullec JY, Crozat Y, Patrois J, Porcheron P. Development of primary cell cultures from the penaeid shrimps Penaeus vannamei and P. indicus. Journal of Crustacean Biology. 1996 Oct 1;16(4):643-9.
Uphoff CC, Drexler HG. Detection of Mycoplasma contamination in cell cultures. Current protocols in molecular biology. 2014 Apr;106(1):28–4.
Vcelar S, Jadhav V, Melcher M, Auer N, Hrdina A, Sagmeister R, Heffner K, Puklowski A, Betenbaugh M, Wenger T, Leisch F. Karyotype variation of CHO host cell lines over time in culture characterized by chromosome counting and chromosome painting. Biotechnology and bioengineering. 2018 Jan;115(1):165–73.
Ward RD, Zemlak TS, Innes BH, Last PR, Hebert PD. DNA barcoding Australia’s fish species. Philosophical Transactions of the Royal Society B: Biological Sciences. 2005 Oct 29;360(1462):1847–57.
Wehbe K, Vezzalini M, Cinque G. Detection of mycoplasma in contaminated mammalian cell culture using FTIR microspectroscopy. Analytical and bioanalytical chemistry. 2018 May;410(12):3003–16.
Wei C, Yang X, Kang M, Cao Z, Sun Y, Zhou Y. An established kidney cell line from humpback grouper (Cromileptes altivelis) and its susceptibility to bacteria and heavy metals. Fish Physiology and Biochemistry. 2022 Jun;48(3):521–33.
Whitehead GG, Makino S, Lien CL, Keating MT. fgf20 is essential for initiating zebrafish fin regeneration. Science. 2005 Dec 23;310(5756):1957-60.
Xing JG, El-Sweisi W, Lee LE, Collodi P, Seymour C, Mothersill C, Bols NC. Development of a zebrafish spleen cell line, ZSSJ, and its growth arrest by gamma irradiation and capacity to act as feeder cells. In Vitro Cellular & Developmental Biology-Animal. 2009 Apr;45(3):163–74.
Zhang J, Hanner R. Molecular approach to the identification of fish in the South China Sea. PLoS One. 2012 Feb 17;7(2):e30621.
Zhao Z, Montgomery-Brock D, Lee CS, Lu Y. Establishment, characterization and viral susceptibility of 3 new cell lines from snakehead, Channa striatus (Blooch). Methods in cell science. 2004 Jan;25(3):155–66.
Zhou ZJ, Sun L. Edwardsiella tarda-induced inhibition of apoptosis: a strategy for intracellular survival. Frontiers in cellular and infection microbiology. 2016 Jul 14;6:76.

Funding

This study was funded by the Indian Council of Agricultural Research (ICAR), New Delhi, India in favour of Dr. Aparna Chaudhari, Principal Scientist, Fish Genetics and Biotechnology Division, Central Institute of Fisheries Education, Mumbai, Maharashtra, India.

Competing Interests

The authors have no competing interests to disclose.

Authors Contributions

Benchwork, data collection, and analysis, first draft writing - Arjunan Sathiyanarayanan

Maintenance of cell line - Yashwanth BS

Assistance in bacterial ECP testing- Nevil Pinto

Guidance and methodology in transfection studies - Dimpal Thakuria

Manuscript curation and validation- Aparna Chaudhari

Guidance in characterization Techniques - Gireesh Babu P

Experimental design, conceptualization, and overall supervision- Mukunda Goswami

Ethics Approval

All applicable institutional guidelines for the care and use of animals were followed and approved by Institutional Animal Ethics Committee (IAEC), ICAR- Central Institute of Fisheries Education, Mumbai, Maharashtra, India.

Consent to Participate/ Publish

All the authors have read, approved the final manuscript, and given their consent to participate in this report and submit it to the journal.

Mitochondrial gene region	Primer Name	Primer sequence (5′-3′)	Length (bp)	References
COI	Fish F1	TCAACCAACCACAAAGACATTGGCAC	26	Ward et al. (2005)
COI	FishR1	TAGACTTCTGGGTGGCCAAAGAATCA	26	Ward et al. (2005)
16S rRNA	16sf1F140	CGYAAGGGAAHGCTGAAA	18	Zhang and Hanner (2012)
16S rRNA	16sf1R1524	CCGGTCTGAACTCAGATCACGTAG	24	Zhang and Hanner (2012)

Table 1. List of primers used for the amplification of mitochondrial genes COI and 16S rRNA.

Components	Volume/reaction (μL)
Template (200 ng/µL)	0.5
Buffer (10 ×)	1.25
Forward primer	0.5
Reverse primer	0.5
dNTPs (10 mM)	0.25
Taq polymerase (5 units/µL)	0.15
D/W	9.35
Total volume - 12.5 µL

Table 2. Composition of PCR master mix for COI and 16S rRNA.

Steps	Condition		Cycles
Steps	Temperature (°C)	Time	Cycles
Initial denaturation	94	5 min	1 cycle
Denaturation	94	30 s	35 cycles
Annealing	54	30 s
Extension	72	45 s
Final extension	72	7 min	1 cycle
Soak	4	Forever	–

Table 3. Thermal regime for cytochrome C oxidase I (COI) gene.

Steps	Condition		Cycles
Steps	Temperature (°C)	Time	Cycles
Initial denaturation	95	5 min	1 cycle
Denaturation	95	40 s	35 cycles
Annealing	53	60 s
Extension	72	45 s
Final extension	72	7 min	1 cycle
Soak	4	Forever	–

Table 4. Thermal regime for 16S rRNA gene.

Download PDF

Version 1

posted

You are reading this latest preprint version

Establishment and characterization of a new fibroblast-like cell line from the skin of a vertebrate model, zebrafish (Danio rerio)

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials & Methodology

3. Results

4. Discussion

5. Conclusion

References

Declarations

Tables

Status:

Version 1