2.1 Chemistry experimental:
Melting points are uncorrected and measured in open glass capillaries. The FT-IR Shimadzu -8400S Spectrophotometer (USA, New York) in KBr pellets used to chart IR spectra (υmax cm‒1). 1H-NMR and 13C-NMR spectra were registered on 300 spectrophotometer Germany, Rheinstetten, 300 and 125MHz respectively in DMSO-d6 solvents and TMS as internal standard. Using Shimadzu GCMS-QP-1000 EX mass spectrometer (Japan, Kyoto) to measure the mass spectra via EI technique (70 e.v.). CHN automatic analyzer used in elemental analyses and measured at Central forced armed Cairo, Egypt. Sonication (model SW 4 cleaner a Toshcon, 37 KHz, 150 W) was achieved the synthesized compounds. Check the purity of synthesized compounds with TLC. All chemical reagents and solvents were achieved from Ali-baba fine chemical company without further purification.
3.1. 1-([1.1- bi-phenyl]-4-yl)-3-(4-methoxy phenyl) prop-2-en-1-one (1):
Grinding a mixture of (0.01 mol, 1.96 g) of 4-acetyl biphenyl, (0.01 mol, 1.49g) 4- dimethylamino benzaldehyde and 2 g of KOH and few drops of water for 20 m until change color of colorless reaction mixture turned light yellow. Then add 50 mL water to the reaction mixture, the solid that separated was filtered, dried and crystallized from ethanol as light yellow crystals , yield: 98% , m.p:88-900C. IR(KBr): ʋcm-1 1679 for C=O and 1600 C=C. 1H NMR (DMSO-d6): δ (ppm): 2.99 (s, 6H, -N(CH3)2); 6.8 - 8.02 (m, 13H, Ar-H; biphenyl and phenyl groups);7.82 (dd,1H, H-C=, J=16.2 Hz); 8.02 (dd, 1H, H-C=, J=16.2 Hz). 13C-NMR (DMSO) 41.9, 111.3, 121.5, 128.1, 129.4, 130.1, 136.6, 140.9, 145.3, 146.4, 150.5, 188.9. Ms: m/z (% abundance): 327 M.+, (100 %); 329 [M+2].+, (3.3%). Anal. For: C23H21NO (327). Cal: %C, 84.37; %H, 6.46; %N, 4.28. Found: %C, 84.23; %H, 6.24; %N, 4.12.
3.2. General procedure for synthesis of Azacoumarin derivatives (4a-f)
3.2.1. Method (i): Sonication a mixture of chalcone (1) (1mmol), ethyl cyanoacetate, ethyl acetoacetate or diethyl malonate (1mmol), and ammonium acetate (0.04 mol) together in a mortar by transfer into 10 mL ethanol in RBF that was located in an ultrasonic cleaning bath Emax measured at 30°C. Reaction progress sustained until disappear the reactants by TLC. Irradiation 20–25 m, afforded yellow solid product, decanted with crushed ice, dried and was recrystallized.
3.2.2. Method (ii): Grinding a mixture of chalcone (1mmol), ethyl cyanoacetate, ethyl acetoacetate or diethylmalonate (1 mmol), and ammonium acetate (0.04 mol) together in an agate mortar and pestle checked by TLC for 25–30 m until the color of reaction mixture turned into yellow, left overnight and was recrystallized from ethanol.
4-Amino-7-(3,4-dichlorophenyl)-5-(4-methoxy phenyl)-2-oxo-2H-pyrano[2,3-b] pyridine-3-carbonitrile (4a): Yield 1.80 g (82%), light yellow finely crystalline, m.p. 176–178 oC. IR (KBr), ν cm-1: 3404, 3324 (NH), 3055 (CH), 2270 (CN), 1734 (CO), MS (m/z) 437. 1H-NMR (DMSO-d6), δ, ppm, (J, Hz): 7.48–7.86 (12ArH, m, aromatic protons), 8.14 (2H, s, NH2 which exchanged in D2O), and Cal., %: C 60.29, H 2.99, Cl 16.18, N 9.59. for C22H13Cl2N3O3. Found, %: C 60.07, H 2.73, Cl 16.00, N 9.36.
7-([1,1'-Biphenyl]-4-yl)-4-amino-5-(4-methoxy phenyl)-2-oxo-2H-pyrano[2,3-b] pyridine-3-carbonitrile(4b): Yield 2.08 g (84%), light yellow finely crystalline, m.p. 184–186 oC. IR (KBr), ν, cm-1: 3211 (NH), 3045 (ArH), 1720 (C=O), MS (m/z) 445. 1H-NMR (DMSO-d6), δ, ppm, (J, Hz): δ: 3.35 (s, 3H, OMe), 7.47–8.19 (m, 13H, ArH), 9.41 (2H, s, acidic NH proton which exchanged in D2O), and Cal., %: C 75.50, H 4.30, N 9.43, for C28H19N3O3. Found, %: C 74.95, H 4.04, N 9.32.
3-Acetyl-7-(3,4-dichlorophenyl)-5-(4-methoxyphenyl)-4-methyl-2H-pyrano[2,3-b] pyridin-2-one (4c): Yield 2.08 g (84%), light yellow finely crystalline, m.p. 184–186 oC. IR (KBr), ν, cm-1: 3428 (OH, enol due to intramolecular H bond), 3045 (ArH), 1736, 1676 (C=O), MS (m/z) 453. 1H-NMR (DMSO-d6), δ, ppm, (J, Hz): δ: 2.28 (s, 3H, Me), 2.67 (s,3H, CH3), 7.47–8.19 (m, 12H, ArH), 9.41 (1H, s, acidic OH proton which exchanged in D2O), and Cal., %: C 63.45, H 3.77, Cl 15.16, N 3.08, for C24H17Cl2NO4. Found, %: C 63.15, H 3.54, N Cl 14.92, N 3.00.
7-([1,1'-Biphenyl]-4-yl)-3-acetyl-5-(4-methoxyphenyl)-4-methyl-2H-pyrano[2,3-b] pyridin-2-one (4d): Yield 1.2 g (71%), light yellow finely crystalline, m.p. 176–178 oC. IR (KBr), ν cm-1: 3479 (OH enol due to intramolecular H bond), 3045 (ArH), 1732, 1669 (C=O), 1H-NMR (DMSO-d6), δ, ppm, (J, Hz): δ: 1.21 (t, 3H, CH3), 4.14 (q, 2H, CH2), 7.63–8.54 (m, 12H, ArH), 9.41 (1H, s, acidic OH proton which exchanged in D2O), and found, %: C 78.08, H 5.02, N 3.03 for C30H23NO4. Calculated, %: C 71.52, H 4.22, N 3.09.
Ethyl 7-(3,4-dichlorophenyl)-4-hydroxy-5-(4-methoxyphenyl)-2-oxo-2H-pyrano[2,3-b] pyridine-3-carboxylate (4e): Yield 2.08 g (84%), light yellow finely crystalline, m.p. 184–186 oC. IR (KBr), ν, cm_1: 3316 (OH), 3045 (ArH), 1733, 1725, 1674 (C=O), MS (m/z) 445. 1H-NMR (DMSO-d6), δ, ppm, (J, Hz): δ: 2.28 (s, 3H, Me), 2.67 (s,3H, CH3), 7.47–8.19 (m, 12H, ArH), 9.41 (1H, s, acidic OH proton which exchanged in D2O), and Cal., %: C 59.28, H 3.52, Cl 14.58, N 3.08, for C24H17Cl2NO6. Found, %: C 63.15, H 3.54, N Cl 14.92, N 3.00.
Ethyl 7-([1,1'-biphenyl]-4-yl)-4-hydroxy-5-(4-methoxyphenyl)-2-oxo-2H-pyrano[2,3-b] pyridine-3-carboxylate (4f): Yield 1.2 g (71%), light yellow finely crystalline, m.p. 176–178 oC. IR (KBr), ν cm-1: 3411 (OH), 3045 (ArH), 1733 (C=O), 1H-NMR (DMSO-d6), δ, ppm, (J, Hz): δ: 1.21 (t, 3H, CH3), 4.14 (q, 2H, CH2), 7.63–8.54 (m, 12H, ArH), 9.41 (1H, s, acidic OH proton which exchanged in D2O), and Calculated %: C 73.01, H 4.70, N 2.84 for C30H23NO6., found, %: C 72.52, H 4.22, N 2.59.
3-(Amino(3-amino-5-oxo-1,5-dihydro-4H-pyrazol-4-ylidene) methyl)-6-(3,4-dichlorophenyl)-4-(4-methoxyphenyl) pyridin-2(1H)-one (5a): Yield 1.80 g (77%), light yellow finely crystalline, m.p. 176–178 oC. IR (KBr), ν cm-1: 3468, 3345 (NH), 3055 (CH), 2220 (CN), 1742 (CO), 1613 (C=N). 1H-NMR (DMSO-d6), δ, ppm, (J, Hz): 7.48–7.86 (12ArH, m, aromatic protons), 8.14 (2H, s, NH2 which exchanged in D2O), and Cal., %: C 56.18, H 3.64, Cl 15.08, N 14.89. for C22H17Cl2N5O3. Found, %: C 56.07, H 3.43, Cl 14.90, N 14.36.
6-(3,4-Dichlorophenyl)-3-(1-(3-hydroxy-5-methyl-4H-pyrazol-4-ylidene) ethyl)-4-(4-methoxyphenyl) pyridin-2(1H)-one (5b): Yield 2.21 g (82%), light yellow finely crystalline, m.p. 184–186 oC. IR (KBr), ν, cm_1: 3045 (ArH), 1744, 1674 (C=O), MS (m/z) 445. 1H-NMR (DMSO-d6), δ, ppm, (J, Hz): δ: 3.35 (s, 3H, OMe), 7.47–8.19 (m, 13H, ArH), 9.41 (2H, s, acidic NH proton which exchanged in D2O), and Cal., %: C 61.55, H 4.09, Cl 15.14, N 8.97 for C24H19Cl2N3O3. Found, %: C 61.35, H 3.82, Cl 14.92, N 8.73.
4-(6-(3,4-dichlorophenyl)-4-(4-methoxyphenyl)-2-oxo-1,2-dihydropyridin-3-yl)-6-methyl-2,5-dihydro-3H-pyrazolo[3,4-d] pyrimidin-3-one (6): Yield 1.45 g (68%), light yellow finely crystalline, m.p. 176–178 oC. IR (KBr), ν cm-1: 3468, 3345 (NH), 3055 (CH), 1742 (CO), 1613 (C=N). 1H-NMR (DMSO-d6), δ, ppm, (J, Hz): 2.54 (s, 1H, CH3), 6.80 (s, 1H, PyH), 7.48–7.86 (7ArH, m, aromatic protons), 8.14, 10.02 (2H, s, 2NH which exchanged in D2O), 12.22 (s, 1H, OH which exchanged in D2O), and Cal., %: C 58.31, H 3.47, Cl 14.34, N 14.17. for C24H17Cl2N5O3. Found, %: C 56.07, H 3.43, Cl 14.90, N 14.36.
2.2 Biological evaluation:
Cell Culture:
liver Cancer cell line of human origin HepG2 (human hepatocellular carcinoma) Cells were routinally cultured in DMEM media (Lonza), supplemented with 10%FBS (Lonza), 1%100u/ml penicillinand 100ug/ml streptomycin(Lonza) in a humidified incubator at 37oC with an atmosphere containing 5%CO2. Every experiment was carried out in triplicate. At 85% confluence cells were harvested using 0.25% trypsin and were subculture into 75 cm2 and six –well plates or 96 –well plates according to selection of experiments. Cells were allowed to attach to the surface for 24 hours prior to treatment. 8-Azacoumarin derivatives were dissolved in DMSO and diluted to appropriate concentrations.
Cytotoxicity evaluation against HepG-2 cell line:
The viability of control and treated cells were evaluated using the MTT assay in triplicate. MTT assay is a laboratory test and a standard colorimetric assay (an assay which measures changes in color) for measuring cellular growth, Yellow MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide, a tetrazole) was reduced to purpleformazan in the mitochondria of living cells. A solubilization solution (dimethyl sulfoxide) was added to dissolving the insoluble purple formazan product into a colored solution. Briefly, HepG2 (hepatocellular carcinoma cell line) was seeded in 96-well plates containing 100µl of the growth medium at a density of (1x104) cells/well. Cells were permitted to adhere for 24h till confluence, washed with PBS, and then treated with different concentration of compounds in fresh maintenance medium from 500 to 15.63 µg and incubated at 37ºC for 24h. A control of untreated cells was made in the absence of the test compound. Untreated cells used as negative control. Serial two-fold dilutions of the tested compounds were added into a 96-well tissue culture plate using a multichannel pipette (Eppendorff, Germany). After treatment (24h), the culture supernatant was replaced by fresh medium. Then, the cells in each well were incubated at 37˚C with 100µl of MTT solution (5mg/ml) for 4h. After the end of incubation, the MTT solution was removed, and then 100µl of DMSO was added to each well. The absorbance was detected at 570 nm using a microplate reader (SunRise TECAN, Inc, USA) [34].
Gamma Irradiation with the derivative:
Gamma irradiation was performed at the National Centre for Radiation Research and Technology (NCRRT), Egyptian Atomic Energy Authority (EAEA), Cairo, Egypt, using Canadian Gamma Cell-40 biological irradiator (137 Cesium), manufactured by the Atomic Energy of Canada Limited, Ontario, Canada. The radiation dose rate was 0.61 Gy/ min at the time of exposure. HepG2 cells were irradiated with 8 Gy with or without the selected derivative. The dose calculated according to the Dosimeter department in the NCRRT.
Quantification of p21 and caspase-3 gene expression & Oxidative stress evaluation: The parameters were estimated in the following groups:
- Control ( HepG-2 cells without treatment).
- IC50 x2 (HepG-2 cells treated with IC50 x 2 = 55 µg/ml, then the cells were harvested after two time intervals 24 hr and 48 hr).
- IC50 (HepG-2 cells treated with IC50 = 27.5 µg/ml, then the cells were harvested after two time intervals 24 hr and 48 hr).
- ½ IC50 (HepG-2 cells treated with IC50 = 13.75 µg/ml, then the cells were harvested after two time intervals 24 hr and 48 hr).
- RAD (HepG-2 cells irradiated with 8 Gy, then the cells were harvested after two time intervals 24 hr and 48 hr).
- RAD + IC50 x2 (HepG-2 cells irradiated with 8 Gy + treated with IC50 = 55 µg/ml, then the cells were harvested after two time intervals 24 hr and 48 hr).
- RAD + IC50 (HepG-2 cells irradiated with 8 Gy + treated with IC50 = 27.5 µg/ml, then the cells were harvested after two time intervals 24 hr and 48 hr).
- RAD + ½ IC50 (HepG-2 cells irradiated with 8 Gy + treated with IC50 = 13.75 µg/ml, then the cells were harvested after two time intervals 24 hr and 48 hr).
Real-time polymerase chain reaction (RT-PCR):
To analyze gene expression of the cell cycle inhibitor p21 and caspase-3. Total RNA was extracted from the collected cell suspension using RNeasy Mini Kit (Qiagen, Cat. No. 74104) according to the manufacturer’s instructions. First strand complementary DNA (cDNA) synthesis was performed using QuantiTect Reverse Transcription Kit (Qiagen, Cat. No. 205311) according to the manufacturer’s instructions using 1μg RNA as a template. RT-PCR were performed in a thermal cycler step one plus (Applied Biosystems, USA) using the Sequence Detection Software (PE Biosystems, CA). The primers utilized in these experiments are listed in Table 2. The reaction mixture of total volume 25 μl was consisting of 2X SYBR Green PCR Master Mix (Qiagen, Cat. No. 204143), 900 nM of each primer and 2μL of cDNA. PCR thermal-cycling conditions included an initial step at 95°C for 5 min; 40 cycles at 95°C for 20s, 60°C for 30s, and 72°C for 20s. The relative expression of the real-time reverse transcriptase PCR products was determined by the ΔΔCt method. This method calculates a relative expression to housekeeping gene using the equation: fold induction = 2-(ΔΔCt). Where ΔΔ Ct=Ct [gene of interest (unknown sample)-Cthousekeeping gene (unknown sample)] - [Ct gene of interest (calibrator sample) - Ct housekeeping gene (calibrator sample)] [35].
Determination of plasma Malondialdehyde (MDA):
Lipid peroxidation in cells was measured by spectrophotometric analysis of MDA based on its reaction with thiobarbituric acid using Colorimetric kit supplied by biodiaganostic, 29 El-Tahrer St. - Dokki- Giza – Egypt.
Determination of Reduced Glutathione (GSH):
GSH was assayed based upon the development of a relatively stable yellow color when 5,5'-dithiobis-(2-nitrobenzoic acid) is added to sulphdril compounds using Colorimetric kit supplied by biodiaganostic, 29 El-Tahrer St. - Dokki- Giza – Egypt.
Table 2: primer sequences for the genes amplified.
Gene
|
Strand
|
Sequence 5` - 3`
|
Product length (bp)
|
Ref. Seq.
|
cyclin-dependent kinase inhibitor p21
|
F
|
GCACAAGGGTACAAGACAGTG
|
220
|
NM_001291549
|
R
|
CGATGGAACTTCGACTTTGTCA
|
caspase 3 (CASP3)
|
F
|
AGA ACT GGA CTG TGG CAT TGA G
|
191
|
NM_004346
|
R
|
GCT TGT CGG CAT ACT GTT TCA G
|
GAPDH
|
F
|
AGGGGCCATCCACAGTCTTC
|
258
|
NM_001357943
|
R
|
AGAAGGCTGGGGCTCATTTG
|