Human Tissue Collection
The Ethics Committee of the Hospital and Medical College approved this study and waived the requirement for informed consent. Eighty-five surgical IVD tissue samples were obtained from patients undergoing micro discectomy procedures for the treatment of LBP and root pain caused by prolapse of the IVD from January 2013 to January 2016. Each sample was obtained from the protrusive region of the IVD. The average LBP intensity was reported by the patient on a 0–10 numerical rating scale (NRS): 0 = no pain, 10 = worst possible pain. (Table 1)
Table 1
Characteristics of the 85 patients included in the study
Modic Type | Sex | Population | Age | Sample Level | Population | NRS score |
Control Group | M F | 5 15 | 48.81 ± 9.93 | L1/2 | 2 | 3.3 ± 2.1 |
L2/3 | 1 |
L3/4 | 3 |
L4/5 | 8 |
L5/S1 | 6 |
Modic Type 1 | M F | 9 6 | 42.6 ± 12.88 | L1/2 | 2 | 4.2 ± 1.6 |
L4/5 | 9 |
L5/S1 | 4 |
Modic Type 2 | M F | 10 30 | 55.69 ± 11.03 | L1/2 | 2 | 3.6 ± 1.7 |
L2/3 | 4 |
L3/4 | 5 |
L4/5 | 12 |
L5/S1 | 17 |
Modic Type 3 | M F | 4 6 | 64.6 ± 7.3 | L2/3 | 1 | 4.3 ± 1.7 |
L4/5 | 6 |
L5/S1 | 3 |
Values are presented as the mean ± SD. |
As shown in Fig. 1, patients were included with MC 1, MC2, and MC3 according to the inclusion criteria for MCs on MRI. The exclusion criteria were as follows: mixed MCs, ankylosing spondylitis, scoliosis, vertebral fractures, lumbar spine infection, spinal tumors, metastatic lesions, and other spine-related diseases; diabetes, hypertension, and other relevant medical history; history of spinal surgery, smoking, alcoholism, or drug use; psychological disorders, mental disorders, and other systemic disorder.
Isolation Of Np Cells And Treatments
NP cells from three patients of each group (L4/5, mean age of 55.16 years, 4 males and 8 females) were isolated using a previously described method.[13] After isolation, cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) with 10% fetal bovine serum (FBS) supplemented with antibiotics. For hypoxic culture, NP cells were cultured in a tri-gas incubator (Huaxi Electronics Technetronic Co, ltd) under the condition of a mixture of 1% O2, 5% CO2, and 94% N2 for 8 h.
Protein Isolation And Western Blotting
NP tissues from three patients of each group were placed on ice immediately and washed with pre-cooled PBS buffer solution, followed by homogenization in RIPA (Aspen, China) supplemented with phenylmethanesulfonyl fluoride, as well as protease and phosphatase inhibitors (Aspen, China). Tissue lysates were sonicated on ice, and protein concentrations were determined using the BCA protein assay kit (Sigma). The extracted proteins were resolved on 10% SDS-PAGE gels and blotted onto PVDF membranes (EMD Millipore Corporation, US), which was blocked with 5% non-fat dry milk in TBST at room temperature for 1 h. Membranes were then incubated overnight 4 °C with primary antibodies. The membrane was then washed with TBST three times, and the protein bands were developed using horseradish peroxidase (HRP)–conjugated secondary antibody (Proteintech) at room temperature for 1 h. Resulting banding was detected using enhanced chemiluminescent detection reagents.
Rna Extraction And Real-time Polymerase Chain Reaction (rt-pcr)
MC tissue was frozen in liquid nitrogen and ground into a fine powder under liquid nitrogen using a mortar and pestle. Total RNA was extracted using the RNeasy Mini kit (Qiagen, Valencia, CA) according to the manufacturer’s protocols. The quantity of the total RNA was measured by a spectrophotometer. Complementary DNA was synthesized using the First Strand cDNA Synthesis Kit (TAKARA, Japan) according to the manufacturer’s instructions. The forward and reverse primers for the target genes are listed in Table 2. RT-PCR was performed on a 96-well plate ABI Prism 7500 (Applied Biosystems, Foster City, CA) using KAPA SYBR FAST qPCR Kit Master Mix. Relative expression was calculated using the 2 − ΔCt method normalized to GAPDH.
Table 2
Primer sequences for Real-Time Polymerase Chain Reaction (RT-PCR)
Gene | | Primer sequence |
Notch 1 | Forward | GCGACAACGCCTACCTCTG |
Reverse | AAGCCATTGATGCCGTCC |
Notch 2 | Forward | TCAGCCGGGATACCTATGAG |
Reverse | CTGGCAGTGTCCTGGAATGT |
Notch 3 | Forward | ACCGCGTGGCTTCTTTCTA |
Reverse | GAGCACTCGTCCACATCCTG |
Notch 4 | Forward | GGAGAAGGGGCTGTGGAAT |
Reverse | GCAGGGGTCAGGAAACTGG |
HES 1 | Forward | GAGTGCATGAACGAGGTGAC |
Reverse | GGTCATGGCATTGATCTGG |
HIF1α | Forward | ACCACCTATGACCTGCTTGG |
Reverse | TATCCAGGCTGTGTCGACTG |
GAPDH | Forward | GCACCGTCAAGGCTGAGAAC |
Reverse | TGGTGAAGACGCCAGTGGA |
Immunohistochemical Analysis
Immunohistochemistry was used to confirm and localize production of HIF-1α and Notch1 in IVDs. Tissue sections were dewaxed and rehydrated, endogenous peroxidases were quenched, and, following heat antigen retrieval, blocked in goat serum. Sections were incubated overnight at 4 °C with rabbit polyclonal antibodies against human HIF-1α and Notch1 (1:200). Pre-immune rabbit IgG (Abcam) was used as a negative control. After washing, sections were incubated with biotinylated goat anti-rabbit antiserum (1:400) and binding was detected by the formation of streptavidin-biotin complex (Vector Laboratories, Peterborough, UK) with 3,3-diaminobenzidine tetrahydrochloride solution (Sigma-Aldrich). Sections were counterstained with Mayer’s Hematoxylin (Leica Microsystems, Milton Keynes, UK), dehydrated, cleared, and mounted in Pertex (Leica Microsystems). Sections were visualized and images captured using an Olympus BX60 microscope and QCapture Pro software (version 8.0, Media-Cybernetics, Marlow, UK). Random fields of view were assessed for immunopositive and immunonegative cells until a total of 200 NP cells were counted in each section; the number of immunopositive cells were expressed as a percentage of the total count.
Statistical Analysis
All measurements were performed in triplicate. Data were analyzed using the Graphpad Prism statistical software (version 7.00). Unpaired t-test was used for comparison between different groups. Differences between groups were assessed by analysis of variance. P values less than 0.05 were considered statistically significant.