Bird’s management
The current study was conducted on four populations of Japanese quail (Coturnix Japonica); brown-feathered (BB), white-feathered quail (WW) varieties and their reciprocal crosses (BWxBW & WBxWB). The bird’s managements were done following the regulations of the animal care and ethics committee of Poultry Production Department, Faculty of Agriculture, Kafrelsheikh University, Egypt. The study continued for two generations after establishing the base population. The number of chicks for each population and the number of selected groups during laying period in the two generations were listed in Table 1.
Table 1
Total number of chicks in each line and the number of selected groups during laying period in three generations
| BXW | BXB | WXW | WXB |
Total number through the experiment |
F1 | 240 | 224 | 110 | 359 |
F21 | 113 | 182 | 77 | 198 |
F22 | 114 | 131 | 70 | 128 |
Number of selected groups during laying period |
| F | M | F | M | F | M | F | M |
F0 | 112 | 56 | 84 | 42 | 64 | 32 | 132 | 66 |
| BW× BW | BB × BB | WW× WW | WB× WB |
| F | M | F | M | F | M | F | M |
F1 | 60 | 30 | 78 | 39 | 50 | 25 | 72 | 36 |
F21 | 34 | 17 | 56 | 28 | 32 | 16 | 42 | 21 |
F22 | 40 | 20 | 34 | 17 | 30 | 15 | 36 | 18 |
One-day old chicks were wing-banded, weighed before being moved to heated brooders where they were reared on floor in a conventional open-sided house until they reached 6 weeks old. Thereafter, they were individually housed in cages (depth: 15 cm; width: 18 cm; height: 18 cm).
The house was equipped with electric and gas heaters where the temperature was kept at 35°C through the first 3 days, 32°C during next 4 days and step by step decreased by 2°C per week until kept at 24°C. Birds received a 24-h lighting photoperiod for the first two weeks depending on the natural and artificial light, followed by a 16 h:8 h light: dark cycle. Food and water were offered ad libitum. Birds were fed a standard diet of 28% crude protein (CP); 3100 kcal metabolizable energy (ME) kg − 1 from 0 to 2 weeks, followed by a grower diet (24% CP and 2900 kcal ME kg− 1) from 4 to 6 weeks of age. During laying period, birds received a layer diet of 20% CP and 2700 kcal ME.
Phenotypic Traits
Body weight (BW) was recorded weekly from the beginning to 6 weeks old then at 12 and 15 weeks old. The number of eggs (EN) laid from the 6th week until 15 weeks old were individually recorded. Egg weight (EW) was also, individually recorded to the nearest 0.1g for three days / week for each hen and the average egg weight was determine per hen.
To assess egg quality, egg weight, albumen height, albumen width, albumen weight, yolk width, yolk height, yolk color, yolk weight, Haugh unit (HU) and eggshell thickness were recorded individually. Where, yolk and albumen height were recorded using tripod micrometer (mm). To evaluate the egg shape index, two axes, transversal and longitudinal of the egg were measured using the Venire callipers then egg-shape index was calculated depending on the following formula: \(Egg shape index =\frac{Transversal axis}{longitudinal axis} \times 100\). Albumen and yolk indices were calculated from their height and width measurements using the following formula: \(Albune or yolk index =\frac{Height}{Width} \times 100\).
At 47 days old, through the F1 and F2, 20 males and 20 females from each quail’s population were randomly selected and euthanized by cervical dislocation after 12 h fasting according to ELSaidy et al [2] to determine carcass traits including; weight after slaughtering, carcass weight (empty carcass), and relative organs weights (%) including; liver, gizzard, heart, intestine, abdominal fat, ovary, testis as well as oviduct.
Biochemical Analysis
At the end of the second generation (F2), blood samples (n = 20/group) were collected from wing vein into tubes without anticoagulant, allowed to coagulate at room temperature then centrifuged at 3000x g for 10 minutes to separate serum, which stored at -20 oC for further analysis. Total cholesterol concertation, creatinine concentration, total antioxidant, lipid peroxide (malondialdehyde), albumin concertation and total lipid concertation were colormetrically determined using an automatic analyzer (Chemwell®, Megazyme, Wicklow, Ireland), and commercial kits (Labtest Diagnóstica S.A, Lagoa Santa, Brazil).
Microsatellite Markers Isolation And Genotyping
The analysis was carried out at Animal Production Biotechnology laboratory, Central Lab Network, National Research Center, Dokki, Egypt. A volume of 3 mL of whole blood were collected from wing veins of 20 individuals from the four quail populations (A = BxB, B = WxW, C = BWxBW & D = WBxWB). Blood samples were collected in sterile tubes containing 0.5 ml EDTA as anticoagulant and stored at – 20°C until DNA extraction. Genomic DNA was extracted using GeneJET Whole Blood Genomic DNA Purification Mini Kit (Thermo Scientific) according to the manufacture instructions. The integrity of DNA was electrophoretically evaluated using 1% agarose gel stained with ethidium bromide (0.5 µg/mL). DNA concentration and purity were assessed using Nanodrop (Eppendorf, Hamburg, Germany) with absorbance at a wavelength of 260 nm and 280 nm.
Three microsatellite markers were used to clarify the variations of phenotypic traits between the four populations of Japanese quail. Full characterization of the analyzed microsatellite markers was presented in a previous study by Kayang et al [7]. The primer sequences of these three microsatellite markers with their annealing temperature, GenBank accession numbers and their length of repeats were shown in Table 2. The PCR mixture was carried out in a total volume of 25 µl containing 50 ng genomic DNA, 10 pmol of each primer, 2.5 µl 10X buffer, 1.5 mM MgCl2, 0.2 mM of each dNTP, and 1 U from Dream Taq (Thermo Scientific). The reaction was accomplished in TM Thermal Cycler (MJ Research PTC-100 thermocycler, USA). The thermal cycling profile included initial denaturation step at 95°C for 5 min followed by 35 cycles of 94°C for 30 sec, annealing at 55°C for 1 min, and extension at 72°C for 1 min, followed by a final extension step of final extension at 72°C for 5 min. PCR successful products were identified on 2% agarose gel in 1X TBE buffer and visualized after staining with ethidium bromide (EtBr).
Table 2
Microsatellite loci, annealing temperatures, primers sequence, gene bank accession numbers, and repeated array and size range.
Locus name | GenBank accession number | Repeat array | Forward primer (5_-3_) | Reverse primer (5_-3_) | Size range (bp) | TA (◦C) |
GUJ0063 | AB063131 | (CA)7CT(CA)2CT(CA)7 | GCTCAGGTTCTCAGCTGATG | GGGAGAGATCAAGGGAACAG | 242–250 | 55 |
GUJ0085 | AB063153 | (GT)14 | ACAACCACTTCTCCAGCTAC | GCTTGTGCTGCTGTTGCTAA | 245–265 | 55 |
GUJ0096 | AB063164 | (A)10(CA)14(A)20 | GTACCAAAAGTGAATAGTGG | CAGATCACAGACTTAGAAAG | 157 | 55 |
Statistical Analysis
GLM procedure of SAS 9.2 (SAS Institute Inc., 2008) was used to analyze the phenotypic Data. All the traits during the fattening and laying periods were analyzed depending on the following linear model: Yijk = µ + Gi +GTj +Gi*GTj+ eijk where µ is the general mean; Gi is the effect of generation (2 levels (F1, F2), GTj is the effect of genetic type or quail’s varieties, Gi*GTj is the effect of interaction between generation and quail’s varieties and eijk is the residual effect. The different levels of each effect included in the models were compared using Duncan´s multiple range test where significance levels were detected as a first-class error at α = 0.05. For carcass traits and blood parameters, the previous model was applied but with adding the sex effect (2 levels). For microsatellite data, the number of alleles for each marker was counted using microsatellite analyzer 4.05 (Dieringer & Schlötterer, 2003). Additionally, the mean number of effective alleles (Ne, the number of equally frequent alleles at a marker), heterozygosity of the 3 SSRs (observed heterozygosity (Ho), expected heterozygosity (He)) in the four quail lines and Polymorphic information content (PIC) were determined using Cervus software package CERVUS 3.0.7 [12]. Fixation index (FIS) was also calculated. The chi-square statistic for Hardy-Weinberg equilibrium (HWE) was calculated for each marker using GENALEX 6.5 (Peakall & Smouse, 2012). Also, using the POPTREE2, a phylogenetic tree of populations depending on the neighbor-joining (NJ) method was constructed.