Materials
FeCl3·6H2O (99%) was purchased from Aladdin (Shanghai, China). Trisodium citrate dihydrate and BSA were purchased from MACKLIN (Shanghai, China). EDC, NHS, DMPO and EV71 monoclonal antibody were purchased from Merck (Darmstadt, Germany). Alexa Fluor 555 dye, Celltracker Green CMFDA and secondary antibody were purchased from Thermo Fisher (Waltham, USA). A TIANamp Virus DNA/RNA Kit (#DP315) was purchased from Tiangen Biotech (Beijing, China). A One-Step TB Green PrimeScript™ RT − PCR Kit II (#RR086A) was purchased from TaKaRa (Beijing, China). TMB was purchased from Solarbio (Beijing, China). SDS lysis was purchased from Beyotime (Shanghai, China). The ROSGreen™ H2O2 probe was purchased from Maokang Biotechnology (Shanghai, China). HPF was purchased from AAT Bioquest (Sunnyvale, USA).
Culture of Para
Paramecium cultures were maintained in lettuce juice medium containing E. coli. as food. The preparation of lettuce juice medium was as follows42,43: fresh lettuce leaves were washed and immersed in boiling water for a few minutes and then placed in cold water to cool. Subsequently, the leaves were treated with the juicer repeatedly and squeezed out through gauze. For use as medium, the juice was diluted 1:40 with KDS buffer (2 mM C6H5Na3O7·2H2O, 0.6 mM KH2PO4, 1.4 mM Na2HPO4, 1.5 mM CaCl2) and incubated with E. coli for 24 hours. Para were cultured in a constant temperature incubator at 25°C.
Synthesis of Fe3O4 magnetic nanoparticles (MNPs)
MNPs were prepared as previously reported44–46. Briefly, FeCl3·6H2O (0.1 M) and trisodium citrate dihydrate (50 mM) were first dissolved in ethylene glycol (30 ml); afterward, NaAc (1.8 g) was added with stirring. The mixture was stirred vigorously for 30 min and then sealed in a Teflon-lined stainless-steel autoclave (50 ml capacity). The autoclave was heated at 200°C, maintained for 10 hours, and then allowed to cool to room temperature. The black products were washed with ethanol and deionized water several times.
The synthesis of Fe3O4@PEI, Fe3O4@PEG and Fe3O4@PAA was similar to that of MNPs, except that the stabilizer was PEI, PEG or PAA instead of sodium citrate.
Preparation of Fe3O4 magnetic nanoparticles modified with a virus-targeted antibody (MNPs@Ab)
The MNPs@Ab was prepared by conjugating EV71 monoclonal antibody to the MNPs. The conjugation was realized through the N-ethyl-N’-(3-dimethylaminopropyl) carbodiimide (EDC)/N-hydroxysuccinimide (NHS) strategy47,48. In detail, 1 ml of MNPs (5 mg/ml) was mixed with EDC (0.1 M) and NHS (0.7 M) for 1 hour at room temperature. The remaining reagents in the coupling reaction were removed via a magnet. Subsequently, the nanoparticles were washed with phosphate-buffered saline (PBS) and finally resuspended in 1 ml of PBS. Next, 100 µl of EV71 antibody solution (1:100) was added to the activated nanoparticle suspension and incubated at room temperature for 2 hours. Any excess unconjugated EV71 antibody was also removed via a magnet. BSA (1%) was used to block the nonspecific active sites.
Construction of E-Para
Para were collected from lettuce juice medium containing E. coli, washed three times with KDS to remove the E. coli and then resuspended in KDS. Two hundred microliters of MNPs@Ab (1 mg/ml) was added to 800 μl Para solution (10000 cells/ml) to reach a final concentration of 200 μg/ml and then coincubated with Para for 2 hours at 25 °C to construct E-Para. The E-Para were then collected via a magnet and resuspended in KDS before further processing.
Survival Rate
The survival rate of Para was evaluated as previously reported32. Para were collected from growth medium and transferred to KDS buffer. Then, different concentrations of MNPs@Ab were added to reach final concentrations of 100, 200, 400, 800 and 1600 µg/ml. The Para were incubated for 24 hours at 25°C. Viable and nonviable cells were counted manually using a stereomicroscope (SZMN, SUNNY OPTICAL, China). Those Para that were immobile and did not preserve their typical shape were considered dead. Control experiments were performed using KDS buffer without any addition of MNPs@Ab. The survival rate (N, %) was calculated as follows:
$$N\left(\%\right)=\frac{{N}_{2}}{{N}_{1}}\times 100\%$$
1
where N2 is the number of live Para after incubation for 24 hours and N1 is the total number of Para at the start of the experiment.
Virus Capture by E-Para
E-Para (8000 cells/ml) were incubated with virus solution for 24 hours at 25 °C. Then, the E-Para-containing virus was removed by magnetic separation. The titers of virus solutions before and after treatment with E-Para were analyzed by RT‒qPCR assay.
RNA isolation and RT‒qPCR
Total viral RNA was extracted using a TIANamp Virus DNA/RNA Kit according to the manufacturer’s instructions and then quantified by one − step quantitative real − time RT − qPCR using a One Step TB Green PrimeScript™ RT − PCR Kit II according to the manufacturer’s protocol with specific primers.
Quantitative RT‒qPCR was performed using an Applied Biosystems 7500 Fast Real-Time PCR System (ThermoFisher, USA). The RT‒qPCR was applied to 20 µl systems (10 µl of 2X One Step TB Green RT‒qPCR Buffer 4, 0.8 µl of PrimeScript 1 Step Enzyme Mix 2, 0.8 µl each of forward and reverse primers (10 µM), 0.4 µl of ROX Reference Dye II (50X)*3, 2 µl of total RNA, 5.2 µl of RNase Free dH2O). RT‒qPCR response procedures (Stage 1: 1 cycle at 42°C for 5 min; Stage 2: 95°C for 10 s; Stage 3: 40 cycles at 95°C for 3 s, 60°C for 30 s; Stage 4: 1 cycle at 95°C for 15 s, 60°C for 1 min, 95°C for 15 s) were applied according to the manufacturer’s instructions.
The primers used for RT‒qPCR are listed in Table 149.
Table 1
Primers used for the RT‒qPCR analysis of EV71.
Primer | Sequence |
EV71-F | GGCCATTTATGTGGGTAACTTTAGA |
EV71-R | CGGGCAATCGTGTCACAAC |
Fluorescence imaging
Fluorescence staining of EV71. One hundred microliters of virus solution was added to 500 μl of preprepared NaHCO3-Na2CO3 buffer solution (pH=9.0), followed by 6 μl of AF555 dye solution dissolved in DMSO. The obtained mixed solution was injected into a dialysis bag and placed in normal saline for 48 hours at 4 °C.
The fluorescence staining of E-Para and Para. Cell Tracker™ Green CMFDA dye solution (1 μl) was added to 1 ml concentrated E-Para solution. The obtained mixed solution was incubated for 30 min at 25 °C. The stained E-Para and Para were washed three times with KDS to remove excess dye.
The stained E-Para or Para were coincubated with stained virus for 4 hours at 25 °C and fixed with paraformaldehyde (4%) for 12 hours at 4 °C. The fluorescence images were collected by CLSM (BX61, Olympus, Japan).
Plaque-forming assay
The infectivity of EV71 in solution and in Para was assessed by plaque-forming assays in RD cells. For EV71 in solution, the virus solutions were diluted in PBS in a dilution series of 1:10. RD cells were seeded in a 12-well plate for 48 hours, and then cells were infected with 1 ml of 10-fold viral dilutions for 1 hour at 37 °C. For EV71 in E-Para and Para, the Para-containing virus was lysed at a concentration of 1:10 in SDS lysis buffer and KDS for 10 min to release the virus in Para, and the resulting virus solution was then diluted 10-fold to infect the RD cells for 1 hour at 37 °C. The viral supernatants were replaced with DMEM containing low-melting-point agarose (1%) and FBS (2%). The cells were then incubated at room temperature for 20 min to solidify and then incubated at 37 °C for another 4-5 days. Cells were then fixed with formaldehyde (4%) for 30 min at room temperature, followed by staining with crystal violet solution (1%) for 15 min. Finally, all visible plaques were photographed and counted, and the final titers were calculated accordingly.
In vitro •OH detection by EPR
•OH generated by the Fenton-like reaction between MNPs@Ab and H2O2 was detected using an EPR spectrometer (A300, Bruker, USA) at room temperature. 5,5-Dimethyl-1-pyrroline-N-oxide (DMPO) was used as a spin trap for the detection of •OH. Then, 100 μl of DMPO (0.15 M) was added to 50 μl of MNPs@Ab solution and detected immediately after the addition of 50 μl of H2O2 (10 M). H2O2 and MNPs@Ab only were used as controls. The settings of the EPR measurement parameters were as follows: 20.5 mW microwave power, 120 G scan range and 2 G amplitude modulation.
Peroxidase-like activity of E-Para
Qualitative analysis. One hundred microliters of TMB single-component substrate solution was added to 900 μl of KDS containing Para (8000 cells/ml). The mixture of TMB and E-Para was incubated for 20 min at 25 °C in the dark. The photographs were collected with an inverted fluorescence microscope (IX73, Olympus, Japan).
Quantitative analysis. One hundred microliters of TMB single-component substrate solution was added to 900 μl of KDS containing Para (8000 cells/ml) or 900 μl of MNPs@Ab solution (200 μg/ml). The mixture of TMB and E-Para was incubated for 20 min at 25 °C in the dark, and then 100 μl of SDS lysis buffer was added and incubated for another 10 min. Then, 100 μl of the above mixed solution was added to a 96-well plate, and the absorbance at 652 nm was measured with a microplate reader (Synergy H1, BioTek, USA). Three parallel groups were set up for each sample.
In vivo H2O2 measurement
Qualitative analysis. The intracellular H2O2 levels of E-Para and Para were measured by ROSGreen™. Briefly, 500 μl of ROSGreen™ H2O2 Probe (10 μΜ) was added to 500 μl of KDS containing Para (8000 cells/ml) and incubated for 30 min at room temperature in the dark. After that, the Para were fixed with paraformaldehyde (4%) for 1 hour at room temperature, washed three times with KDS and observed by the FITC channel of an inverted fluorescence microscope (IX73, Olympus, Japan).
Quantitative analysis. Fifty microliters of ROSGreen™ H2O2 Probe (10 μΜ) was added to 50 μl of KDS containing Para (8000 cells/ml) and incubated in a black 96-well plate with a clear bottom for 30 min at room temperature in the dark. Four parallel groups were set up for each sample. The fluorescence intensity was measured and recorded by means of a fluorescence microplate reader (Synergy H1, BioTek, USA) at 490 nm excitation and 525 nm emission. KDS was used as a control. The intracellular H2O2 level was calculated according to the fluorescence value and standard curve of H2O2 (Supplementary Fig. 16).
In vivo •OH measurement
Qualitative analysis. The intracellular •OH levels of E-Para and Para were measured by HPF. Briefly, 500 μl of an HPF working solution (20 μΜ) was added to 500 μl of KDS containing Para (8000 cells/ml) and incubated for 45 min at room temperature in the dark. After that, the E-Para and Para were fixed with paraformaldehyde (4%) for 1 hour at room temperature and washed three times with KDS. Then, the E-Para and Para were observed by the FITC channel of an inverted fluorescence microscope (IX73, Olympus, Japan).
Quantitative analysis. The fluorescence intensity of HPF was measured by ImageJ software (Version 1.51j8, USA).
Magnetic recovery
The E-Para containing virus was collected with a magnet. The number of E-Para collected by magnetic force and the total number of E-Para were recorded manually with a stereomicroscope (SZMN, SUNNY OPTICAL, China). The magnetic recovery efficiency (M, %) of E-Para was calculated according to the following formula:
$$M\left(\%\right)=\frac{{M}_{2}}{{M}_{1}}\times 100\%$$
2
where M2 is the number of E-Para collected by magnetic force and M1 is the total number of Para.
Date availability
The authors declare that data supporting the findings of this study are available within the article and its Supplementary Information files. All relevant data are available from the corresponding author upon reasonable request.