Evaluation of resistance to powdery mildew and identification of resistance genes in wheat cultivars

doi:10.21203/rs.3.rs-19487/v1

Background: Wheat powdery mildew, caused by the biotrophic fungus Blumeria graminis f. sp. tritici ( Bgt ), is a serious disease of wheat worldwide that can cause significant yield losses. Growing resistant cultivars is the most cost-effective and eco-soundly strategy to manage the disease. Therefore, a high breeding priority is to identify genes that can be readily used either singly or in combination for effective resistance to powdery mildew and alos in combination with genes for resistance to other diseases. Yunnan Province, with complex and diverse ecological environments and climates, is one of the main wheat growing regions in China. This region provides initial inoculum for starting epidemics of wheat powdery mildew in the region and other regions and thus, plays a key role in the regional and large-scale epidemics of the disease throughout China. The objectives of this study were to evaluate seedling resistance of 69 main wheat cultivars to powdery mildew and to determine the presence of resistance genes Pm3 , Pm8 , Pm13 , Pm16 , and Pm21 in these cultivars using gene specific DNA markers.

Results: Evaluation of 69 wheat cultivars with six Bgt isolates showed that only four cultivars were resistant to all tested isolates, indicating that the overall level of powdery mildew resistance of Yunnan wheat cultivars is inadequate. The molecular marker results showed that 27 cultivars likely have at least one of these genes. Six cultivars were found likely to have Pm3 , 18 likely to have Pm8 , 5 likely to have Pm16 , and 3 likely to have Pm21 . No cultivar was found to carry Pm13 .

Conclusion: The information on the presence of the Pm resistance genes in Yunnan wheat cultivars can be used in future wheat disease breeding programs. In particular, cultivars carrying Pm21 , which is effective against all Bgt races in China, should be pyramided with other effective genes to developing new cultivars with durable resistance to powdery mildew. Keywords: Blumeria graminis f. sp. tritici , Pm gene, molecular markers, wheat

Plant Molecular Biology and Genetics

Blumeria graminis f. sp. tritici

Pm gene

molecular markers

wheat

Wheat (Triticum aestivum L.) is one of the most important food crops, which plays a very key role in the world food supply and food security, but its production is constantly challenged by various diseases [1, 2]. Powdery mildew, caused by the biotrophic fungus Blumeria graminis f. sp. tritici (Bgt), is one of the most serious diseases limiting wheat production in many regions of the world [3]. Breeding and growing resistant cultivars is generally considered to be the most economical, effective, and environmentally friendly method to control this disease [4, 5]. The first powdery mildew (Pm) resistance gene in wheat was found in wheat variety ‘Thew’ by Australian researcher Waterhouse in 1930 [6]. Since then, new powdery mildew resistance genes have been identified from common wheat and wheat relatives. In the meantime, the inheritance characteristics and chromosome locations of powdery mildew resistance genes were studied extensively [7–9]. To date, over 91 Pm resistance genes, mapped to 58 loci, have been characterized, and new genes are continually described in common wheat and relatives [2, 10–13]. Many of these Pm genes have been used widely in wheat breeding programs [12]. Unfortunately, the Pm genes only confer resistance to specific Bgt races, and the race-specific nature is not ideal, since virulent mutants of Bgt can escape recognition of the resistance gene and making resistance genes ineffective [2]. For instance, the resistance gene Pm8, in a cluster with Yr9, Lr26, and Sr31 for resistance to stripe rust, leaf rust, and stem rust, respectively, on 1BL/1RS was transferred into wheat cultivars from ‘Petkus’ rye in 1970s, and has a profound impact on wheat disease resistance breeding in the world [14]. Since then, a large number of wheat cultivars carrying 1BL/1RS have been released and widely grown in the world due to the resistance to multiple diseases. However, the overuse of the 1BL/1RS translation in breeding and production has resulted in the rapid emergence of new pathotypes with the corresponding virulence genes, which have overcome the resistance genes, leading to serious epidemics of these diseases [15, 16].

Recently, powdery mildew has become more significant with increased use of nitrogen fertilizer, changes in irrigation, and the increase of global average temperature [17]. Therefore, cultivars become susceptible more quickly under the high disease pressure and more rapid changes of virulence in the pathogen population. Knowledge of the identity of race-specific resistance genes in wheat cultivars is a requirement to identify which resistance genes becoming ineffective. The use of molecular marker assisted selection breeding is a quick and easy approach to identify resistance genes. Molecular markers have been used to identify resistance genes against various diseases in wheat. Among various types of markers, simple sequence repeat (SSR) and single-nucleotide polymorphism (SNP) markers have recently been widely used in studying genes for resistance to powdery mildew [18–20].

Yunnan Province, located in the southwest of China, has complex and diverse ecological environments and climates. In this region, wheat powdery mildew is very serious and epidemic occurs every year. Because of the disease-favorable environments, Yunnan provides initial inoculum for wheat powdery mildew, stem rust, leaf rust, and stripe rust, playing a key role in the regional spread and large-scale epidemic of the diseases in China [21, 22]. Therefore, assessment of the resistance level of the main production cultivars to these diseases as well as identification of resistance genes in the cultivars can provide a theoretical basis for diseases management by rationally deploying cultivars with various resistance genes in different areas. Resistance to stripe rust in Yunnan wheat cultivars has been studied by Li et al. (2013) [23]. In our previous study, resistance to stem rust in main wheat cultivars of the region was also studied [22, 24]. In recent years, the epidemic level of powdery mildew has been increasing in Yunnan [17]. Therefore, this study was carried out to determine the level of seedling resistance to powdery mildew and to identify Pm genes in wheat cultivars use molecular markers. This information will be useful for developing wheat cultivars with durable resistance to powdery mildew.

Wheat seedling resistance to B. graminis f. sp. tritici

The powdery mildew infection types of 69 main wheat cultivars and breeding lines to all tested isolates were presented in Table 1. Five wheat cultivar, De 4–8, Kunmai 4, Yixi 2003-64, Yimai lines 2003-13, and Yimai lines 2003-27 were resistant (Infection types 0–2) to all tested isolates at seedling stage, accounting for only 5.8% of the tested cultivars and breeding lines. The remaining 64 wheat cultivars were susceptible to one or more tested isolates (Fig. 1, Table 1).

Table 1

Percentagess of susceptible and resistant wheat cultivars to six isolates of Blumeria graminis f. sp. tritici.
Isolates	Susceptible
Isolates	Number of cultivras	Percentage (%)	Number of cultivras	Percentage (%)
09558-1	61	88.4	8	11.6
W1	46	66.7	23	33.3
W12	54	78.3	15	21.7
L14	54	78.3	15	21.7
T7	56	81.2	13	18.8
H1-5-1	61	88.4	8	11.6
All tested isolates	65	94.2	4	5.8

Molecular identification of Pm3

Pm3 is a single, dominant locus on the short arm of wheat chromosome 1A and contains a more alleles than any other identified Pm loci [25]. Seven specific markers for the Pm3 alleles (Pm3a - Pm3g) based on nucleotide polymorphisms of coding and adjacent noncoding regions were used to identify Pm3 alleles in the wheat cultivars. The specific fragment of 624-bp for Pm3a was amplified in the positive control Asonsan/8 cc that is known to carry Pm3a and six cultivars (Fengmai 35, Jing 0202, Liangmai 4, Wenmai 11, Yumai 3, and Yunmai 51), indicating that these cultivars carry Pm3a (Fig. 2a, Table 2).

Table 2

Seedling infection types to Blumeria graminis f.sp. tritici and resistance genes detected with molecular markers
Cultivar/line	Infection types^a
Cultivar/line	09558-1	W1	W12	L14	T7	H1-5-1	Pm3	Pm8	Pm13	Pm16	Pm21
017 − 10	4	3	4	3	3	4	-	-	-	-	-
02D2-282	4	4	4	4	4	4	-	-	-	-	-
06D6-6	4	4	4	4	4	3	-	-	-	-	-
91E001	4	3	3	4	3	4	-	-	-	-	-
Chumai 12	3	4	3	4	4	4	-	-	-	-	-
De 4–8	0	0	0;	0	0;	0	-	-	-	-	+
De 05–81	3	4	4	3	4	3	-	+	-	-	-
De 08 − 3	2	0	0	1	0;	0	-	-	-	-	-
Demai 3	4	3	4	3	3	3	-	-	-	-	-
Demai 4	3	3	4	4	4	4	-	+	-	-	-
Demai 5	4	4	4	3	3	4	-	-	-	-	-
Demai 7	4	4	4	4	4	4	-	+	-	-	-
E33	4	3	4	4	3	3	-	+	-	-	-
Feng 05-394	4	3	4	4	3	4	-	-	-	-	-
Feng 1124	3	2	3	0	3	3	-	-	-	+	-
Fengmai 13	4	3	4	3	4	4	-	-	-	-	-
Fengmai 24	4	4	4	4	4	4	-	-	-	-	-
Fengmai 34	3	3	4	4	4	4	-	-	-	-	-
Fengmai 35	4	2	0	3	3	3	+	-	-	-	-
Fengmai 36	4	3	4	4	3	3	-	-	-	-	-
Fengmai 37	4	0	2	3	0	3	-	-	-	-	-
Fengmai 38	4	0;	0	4	3	4	-	-	-	-	-
Fengmai 39	4	3	4	2	4	3	-	-	-	-	-
Fengyin 03 − 2	4	2	4	2	3	4	-	-	-	+	-
Jing 0202	3	2	3	4	0	4	+	+	-	-	-
Jing 06 − 4	3	3	4	3	4	4	-	+	-	-	-
Jingmai 11	4	0	0;	3	4	3	-	+	-	-	-
Jingmai 12	4	3	4	4	3	4	-	+	-	-	-
Jingmai 14	4	4	3	4	4	4	-	+	-	-	-
Kun 022-222-1	4	4	3	3	4	4	-	-	-	-	-
Kunmai 4	0	0;	0	1	0	1	-	-	-	-	+
Kunmai 5	4	3	0	0;	4	4	-	+	-	-	-
Liangmai 4	4	2	4	1	3	3	+	+	-	-	-
Linmai 15	3	4	4	4	3	4	-	+	-	-	-
Linmai 6	4	4	3	4	4	4	-	-	-	-	-
Mentana	3	3	4	3	3	3	-	-	-	-	-
Mian 1971-98	4	0;	3	4	4	3	-	-	-	-	-
Mianyang 19	3	3	4	3	4	4	-	-	-	-	-
Mianyang 20	4	4	3	4	4	4	-	-	-	-	-
Nanyuan 1	4	3	3	4	3	4	-	-	-	-	-
R101	3	4	3	3	3	3	-	-	-	-	-
R57	4	0	4	3	2	4	-	+	-	-	-
Wenmai 11	4	0;	4	3	1	4	+	+	-	-	-
Wenmai 12	4	3	1	2	4	3	-	+	-	-	-
Yimai 1	4	4	4	4	4	4	-	-	-	-	-
Yimai 10	3	4	4	4	4	4	-	-	-	-	-
Yimai lines 2003-13	1	0	1	0;	1	1	-	-	-	-	-
Yimai lines 2003-27	0	1	1	0;	1	0;	-	-	-	-	-
Yixi 2003-64	0;	0	1	0;	1	0	-	-	-	-	+
Yumai 1	4	4	4	4	4	4	-	+	-	-	-
Yumai 3	3	2	4	3	3	4	+	+	-	-	-
Yunmai 101	3	4	3	3	4	4	-	+	-	-	-
Yunmai 11–12	4	3	4	4	3	4	-	-	-	-	-
Yunmai 29	4	3	4	3	4	4	-	-	-	-	-
Yunmai 39	3	3	2	3	4	4	-	-	-	+	-
Yunmai 42	3	3	4	3	3	4	-	-	-	+	-
Yunmai 43	4	4	3	3	4	1	-	-	-	-	-
Yunmai 47	3	4	4	4	3	3	-	-	-	-	-
Yunmai 48	2	4	3	0	4	4	-	-	-	-	-
Yunmai 51	4	0;	4	3	3	3	+	-	-	-	-
Yunmai 52	4	4	3	4	3	4	-	-	-	-	-
Yunmai 53	3	2	3	0	0;	1	-	-	-	-	-
Yunmai 54	4	3	4	4	3	4	-	-	-	-	-
Yunmai 56	3	0	0	4	1	3	-	-	-	-	-
Yunmai 57	4	4	0	3	0;	4	-	-	-	-	-
Yunxuan 3	4	3	3	4	4	4	-	-	-	-	-
Yunza 5	4	4	3	3	3	3	-	-	-	-	-
Yunza 6	4	4	4	3	4	3	-	-	-	-	-
Yunza 7	4	3	4	4	3	4	-	-	-	-	-

Molecular identification of Pm8

The best known and widely deployed Pm8 is located on a 1BL.1RS translocation in hexaploid wheat. It was originally derived from the introgression of the 1RS rye chromosome from rye cultivar ‘Petkus’. A sequence-tagged site (STS) marker, IAG95, was developed to identify Pm8 [26]. Wheat cultivars with the chromatin from ‘Petkus’ carry the resistance allele amplified as 1050 bp fragment by the IAG95 primer pair. In this study, the positive control ‘Kavkaz’ (Pm8) and 18 wheat cultivars had the 1050 bp fragment, indicating that these carry Pm8 (Fig. 2b).

Molecular identification of Pm13

Cenci et al. (1999) amplified a 517-bp specific fragment in cultivars containing the Pm13 genes by using STS UTV14F/R primers [27]. A 517-bp fragment was amplified in the wheat line R4A (Pm13) as a positive control, and no fragment was amplified in the negative control Chancellor as expected. However, no specific fragment was amplified in all tested wheat cultivars and breeding lines, indicating that none of these wheat varieties (lines) carry Pm13.

Molecular identification of Pm16

SSR marker Xgwm159 for Pm16 developed by Chen et al. (2005) was used to test wheat cultivars and breeding lines [28]. PAGE (polyacrylamide gel electrophoresis) showed that the fragment amplified by the varieties containing Pm16 was about 201-bp, while the fragment amplified by the varieties without Pm16 was about 190-bp. Cultivars Yunmai 39, Yunmai 42, Yunmai 47, Feng 1124 and Fengyin 03 − 2 had the same fragment as the positive control of the Pm16 single-gene line indicating that these five cultivars contain Pm16.

Molecular identification of Pm21

Liu et al. (1999) detected a 1265-bp fragment in Yangmai 5/Sub-6V (Pm21) by amplification using the STS 1265 marker of Pm21 [29]. In our study, this specific fragment was amplified in the Pm21 positive control, but not in the susceptible control Chancellor. This gene was also detected in cultivars Kunmai 4, Yixi 2003-64, and De 4–8, but not in the rest of the cultivars and breeding lines, indicating that these three Yunnan cultivars contain Pm21 (Fig. 2c).

Since the 1970s, wheat powdery mildew has been prevalent all over the world, causing different degrees of economic losses every year. Developing powdery mildew resistant cultivars has always been an important breeding goal of wheat. Powdery mildew has been well controlled, and the losses caused by the disease have been reduced in different stages of history. However, in recent years, wheat powdery mildew has been increasing as a result of losses of varietal resistance caused by the high heterogeneity and frequent virulence changes in the pathogen population. Many wheat cultivars planted at present show a trend of high susceptibility to powdery mildew. Therefore, it is urgent to improve resistance to powdery mildew. In the present study, the resistance level of wheat cultivars in Yunnan province to six Bgt isolates was evaluated. The results showed that most of tested wheat cultivars were highly susceptible to Bgt, indicating that effective genes are lack in Yunnan cultivars. In addition, currently effective genes (Pm13, Pm16, and Pm21) to Bgt in Chinese wheat cultivars are in very low frequencies as only four cultivars contain Pm16, and 3 cultivars contain Pm21, while no cultivars contain Pm13. Therefore, in order to improve the resistance level of wheat cultivars to powdery mildew, it is necessary to pyramid some other effective genes into new cultivars.

The Pm3 locus was one of the first described loci for resistance to powdery mildew [30]. Some of the resistance alleles have been widely used in wheat breeding programs in the many countries including China, and some of the resistance alleles have remained effective [20, 31]. Liu et al. (2019) reported about 95.1% wheat cultivars from Heilongjiang Province carrying Pm3 [32]. In the present study, we identified the gene in only six cultivars grown in Yunnan (Fengmai 35, Jing 0202, Liangmai 4, Wenmai 11, Yumai 3, and Yunmai 51).

The gene Pm8 on 1BL/1RS was transferred into many bread wheat cultivars from ‘Petkus’ rye [33]. The 1BL/1RS translocation has been play an important role in wheat disease resistance breeding in the world, because this locus is closely linked to disease resistance genes, including Sr31, Lr26, and Yr9 for resistance to stem rust, leaf rust, and stripe rust, respectively. It is reported that more than wheat cultivars grown in 50% of the total wheat planting areas in China carry this translocation [34]. Our results showed that eighteen wheat cultivars contain Pm8, accounting for 26.1% of the tested cultivars from Yunnan. Conversely, pedigree tracking indicated that resistant stocks carrying Pm 8, such as ‘Kavkaz’ and ‘Lovrin’ lines, were widely used in wheat breeding in Yunnan Province, suggesting the origin of resistance genes in these wheat cultivars [22]. Our results were consistent with previous reports. For example, Li et al., (2011) found that the frequency of 1BL/1R translocation in Huang-Huai wheat region was as high as 59% [34]. In addition, no virulent races of P. graminis f. sp. tritici to resistance gene Sr31 has been found in China. Therefore, this gene will still have an impact on wheat breeding for disease resistance, although the resistance to Bgt has been lost in China. Thus, Pm8 should be used in combination with other genes for effective resistance to Bgt in wheat breeding programs to maintain the long-term resistance of cultivars.

Gene Pm13 originated from Aegilops longissima and was located on the 6VS of the translocation chromosome T6AL/6VS of wheat/ Aegilops longissima translocation. It is one of the effective resistance genes to powdery mildew in the world including China. Cenci et al. (1999) was first developed the STS linkage marker of Pm13, which is widely used in marker assisted selection breeding [35]. In our previous study, Pm13 was found to be effective in northeastern China [20]. However, Pm13 was not found in any of the Yunnan wheat cultivars tested in the present study. Similarly, Li et al. (2009) and Liu (2010) did not detected Pm13 in any of the cultivars, including 50 and 101 cultivars from different regions of China [36, 37]. Their results, together with our study, indicate that Pm13 is absent in Chinese wheat cultivars, and this effective gene should be used in breeding programs.

Gene Pm16 was the first wheat powdery mildew resistance genes transferred from Triticum dicoccoides Korn into Triticum aestivum L. and was first reported in chromosome 4A at the earliest [38]. However, subsequent studies did not show a consistent chromosomal location. Wang et al. (2004) reported the gene on 5DS, while Chen et al. (2005) reported it on 5BS. Therefore, multiple markers have been reported for Pm16 [28, 39]. However these markers may not be specific. In the present study, the SSR marker reported by Chen et al. (2005) was used, and four cultivars, Yunmai 39, Yunmai 42, Yunmai 47, and Fengyin 03 − 2, were positive for the marker [28]. The pedigree of Yunmai 39 is Secale cereale L./Fuli wheat/Fticher's, and Yunmai 42 is rust-resistant 782/Secale cereale/Fuli wheat//YKLO-PAM“S”. As S. cereale is susceptible to powdery mildew, Pm16 might originate from common wheat Fuli. The genealogy of Yunmai 47 is 852 − 18/852 − 181//86-4437-75/3/822–852/785// 842–929/4/Gangu436/5/923–3763. As most of genotypes in this pedigree are breeding line numbers, it is impossible to identify the donor for the powdery mildew resistance gene. Fengyin 03 − 2 originated from Anmai 5 (L9288022-2-1/Xingnong 5) in Guizhou. Zhao et al. (2007) found that Anmai 5 was highly resistant to powdery mildew, so Pm16 in Fengyin 03 − 2 may come from Anmai 5 [40]. The pedigree of Feng1124 is E33/58769-6. E33 is an excellent powdery mildew resistant stock imported from Mexico and maycontain Pm16.

Gene Pm21 is derived from Haynaldia villosa, located on the short arm of chromosome 6V (6VS). As this gene has a wide resistance spectrum of Bgt isolates in the world, it has been widely studied [20, 41] Pm21 provides a high level and stable resistance in different genetic backgrounds. Meanwhile, wheat cultivars that carry this gene usually have excellent other agronomic traits. Therefore, this gene has been widely deployed in Sichuan Basin and southern Gansu since the middle 1990s. Since then, Pm21 has been widely used in different wheat production areas in China [42]. Jiang et al., (2014) identified 7.4% of the tested 118 Chinese cultivars contained this gene using markerScar1265 closely linked to Pm21 [43]. Our results showed that cultivars Kunmai 4, Yixi 2003-64, and De 4–8 contain this gene. Kunmai 4 has ALB“S”/BOW“S” in its pedigree, and ALB“S”/BOW“S” is a Chile wheat line highly resistant to powdery mildew. In addition, Li et al. (2012) found Kunmai 4 was highly resistant to all tested Bgt isolates [21]. We found that this cultivar likely have Pm21. As the genealogical information is not available for Yixi 2003-64 and De 4–8, we could not identify the Pm21 donor in these cultivars. Unfortunately only these three cultivars (4.3%) potentially have Pm21 among the 69 tested wheat cultivars and breeding lines from Yunnan. Pm21 should be pyramided with other effective genes to developing wheat cultivars with durable resistance to powdery mildew.

Breeding resistant cultivars is the most cost-effective and eco-soundly strategy to protect wheat from disease. In the present study, the seedling resistance of 69 main wheat cultivars in Yunnan Province were evaluated using 6 isolates of Bgt. Overall, the seedling resistant level of wheat cultivars to powdery mildew resistance were very poor in Yunnan Province. Base on it, the presence of genes Pm3, Pm8, Pm13, Pm16, and Pm21 in these cultivars were detected using gene specific DNA markers. Six cultivars were found likely to have Pm3, 18 likely to have Pm8, 5 likely to have Pm16, and 3 likely to have Pm21. No cultivar was found to carry Pm13. The information on the presence of the Pm resistance genes in Yunnan wheat cultivars can be used in future wheat durable disease breeding programs.

Wheat cultivars and Pm resistance near-isogenic lines

A total of 69 wheat cultivars and breeding lines used in the present study included main cultivars grown in Yunnan province and genetic stocks used in breeding programs, and seeds were provided by Pro. Mingju Li, Institute of Agricultural Environment and Resources, Yunnan Academy of Agricultural Sciences. The pedigrees of the cultivars are listed in Table 3. A set of 37 wheat lines carrying known powdery mildew resistance genes (Table 4) were also used in the present study as Pm gene references, and seeds were provided by Prof. Yilin Zhou, State Key Laboratory for Biology of Plant Diseases and Insect Pests, Institute of Plant Protection, Chinese Academy of Agricultural Sciences.

Isolates of B. graminis f. sp. tritici

Six isolates of B. graminis f. sp. tritici with different virulence patterns were used to evaluate resistance in the wheat cultivars and breeding lines. These isolates were selected from the collection of the Plant Immunity Institute, Shenyang Agricultural University, China. Their virulence/avirulence patterns to the 37 wheat differentials carrying known Pm genes are shown in Table 4.

Evaluation of seedling resistance

The 69 wheat cultivars and breeding lines were evaluated in the seedling stage for resistance to powdery mildew using the six Bgt isolates in the greenhouse at the College of Plant Protection, Shenyang Agricultural University, suing the method described in a previous study [44]. About 10 seeds of each cultivar were sown in a pot of 12 cm in diameter. Highly susceptible cultivar Chancellor was used as a control for evaluating uniformity of inoculation. Plants in different trays were inoculated with the six Bgt isolates separately. When the primary leaves were fully expanded (about 10 days after planting). When the susceptible cultivar Chancellor was heavily infected, about 10 days after inoculation, infection types (ITs) were recorded. The IT score includes 0 (no visible symptoms), 0; (hypersensitive necrotic flecks), 1 (minute colonies with few conidia), 2 (colonies with moderately developed hyphae, but few conidia), 3 (colonies with well-developed hyphae and abundant conidia, but colonies not joined together), and 4 (colonies with well-developed hyphae and abundant conidia, and colonies mostly joined together [45]. ITs 0–2 were considered as ‘R’ (resistant), and ITs 3–4 as ‘S’ (susceptible).

DNA extraction and PCR amplification

Genomic DNA was extracted from 100 mg young leaves of seven-day old seedlings from each cultivar, using a DNA extraction kit (Sangon Biotech, Shanghai, China). Pm-gene specific primers were synthesized by Shanghai Biotech Biotech Co., Ltd, China (Table 5). Polymerase chain reactions (PCR) were carried out using a S1000^TMThermal Cycler in 25 μL volume, including 2 μL of 50 ng·μL^–1 DNA, 1 μL of 10 μmol·L^–1of each primer, 2.5 μL of 10× buffer (Mg²⁺), 0.2 μL of 5 U·μL^–1 Taq polymerase, and 0.5 μL of 10 mmol·L^–1deoxyribonucleoside triphosphates. The PCR procedure was as follows: 94°C for 5 min, 30 cycles of 94°C for 45 s, 60°C for 45 s, and 72°C for 1 min, followed by the final extension at 72°C for 8 min. PCR products were separated on 1.5–2% agarose.

Bgt: Blumeria graminis f. sp. tritici; ITs: infection types; PCR: Polymerase chain reactions; Pm: powdery mildew; SNP: single-nucleotide polymorphism; SSR: simple sequence repeat; STS: sequence-tagged site.

Ethics approval and consent to participate

Not applicable

Consent for Publication

Not applicable

Availability of data and material

All data generated or analysed during this study are included in this published article.

Competing interests

The authors declare that they have no competing interests.

Funding

This study was supported by National Natural Science Foundation of China (No. 31701738). The funders had no role in study design, data collection and analysis, and preparation of the manuscript.

Authors' contributions

TYL, XXW, and YYC conceived and designed the studies. XXW, QB, QS, XYN, YQS, and XFX performed the data analysis and experiments. TYL, XXW and YG wrote the manuscript. All authors have read and approved the final version of the manuscript.

Acknowledgements

We appreciate very much to Prof. Xianming Chen from Department of Plant Pathology, Washington State University, Pullman, WA 99164-6430, USA for critical reading and revising of our manuscript.

Ma PT, Xu HX, Luo QL, Qie YM, Zhou YL, Xu YF, Han HM, Li LH, and An DG. Inheritance and genetic mapping of a gene for seedling resistance to powdery mildew in wheat line X39862. Euphytica. 2014; 200:149–157.
Zhang Y, Bai Y, Wu G, Zou S, Chen Y, Gao C, and Tang D. Simultaneous modification of three homoeologs of TaEDR1 by genome editing enhances powdery mildew resistance in wheat. Plant J. 2017; 91:714–724.
Zhang RQ, Sun BX, Chen AZ, Xing LP, Feng YG, Lan CX, and Chen PD. Pm55, a developmental-stage and tissue-specific powdery mildew resistance gene introgressed from Dasypyrum villosum into commom wheat. Appl. Genet. 2016;129:1975–1984.
Petersen S, Lyerly JH, Worthington ML, Parks WR, Cowger C, Marshall DS, Brown-Guedira G, and Murphy JP. Mapping of powdery mildew resistance gene Pm53 introgressed from Aegilops speltoides into soft red winter wheat. Theor. Appl. Genet. 2015; 128:303-312.
El-Shamy MM, Emara HM, and Mohamed ME. Virulence analysis of wheat powdery mildew (Blumeria graminis f. sp. tritici) and effective genes in Middle Delta, Egypt. Plant Dis. 2016; 100;1927-1930.
Zeller FJ. 1B/1R wheat-rye chromosome substitutions and translocations. In Proc. 4th Int. Wheat Genet. Symposium (Sears, E.R. and Sears, L.M.S, eds). Columbia, MO: University of Missouri, 1973, pp. 209–221.
Bhullar NK, Zhang Z, Wicker T, and Keller B. Wheat gene bank accessions as a source of new alleles of the powdery mildew resistance gene Pm3: a large scale allele mining project. BMC Plant Biol. 2010; 10:88.
Brunner S, Stirnweis D, Diaz QC, Buesing G, Herren G, Parlange F, Barret P, Tassy C, Sautter C, Winzeler M, and Keller B. Transgenic Pm3 multilines of wheat show increased powdery mildew resistance in the field. Plant Biotechno. J. 2012; 10:398–409.
Hanusova R, Hsam SLK, Bartos P, and Zeller FJ. Suppression of powdery mildew resistance gene Pm8 in Triticum aestivum L (common wheat) cultivars carrying wheat-rye translocation T1BL.1RS. Heredity. 1996; 77:383–387.
Hao YF, Parks R, Cowger C, Chen ZB, Wang YY, Bland D, Murphy JP, Guedira M, Brown-Guedira G, and Johnson J. Molecular characterization of a new powdery mildew resistance gene Pm54 in soft red winter wheat. Theor. Appl. Genet. 2015; 128:465–476.
Li H, Jiang B, Wang J, Lu Y, Zhang J, Pan C, Yang X, Li X, Liu W, and Li L. Mapping of novel powdery mildew resistance gene(s) from Agropyron cristatum chromosome 2P. Theor. Appl. Genet. 2017; 130:109–121.
Li G, Cowger C, Wang X, Carver BF, and Xu XY. Characterization of Pm65, a new powdery mildew resistance gene on chromosome 2AL of a facultative wheat cultivar. Theor. Appl. Genet. 2019; 132:2625–2632.
Tan C, Li G, Cowger C, Carver BF, and Xu XY. Characterization of Pm63, a powdery mildew resistance gene in Iranian landrace PI 628024. Theor. Appl. Gene. 2019; 132:1137–1144.
Hurni S, Brunner S, Stirnweis D, Herren G, Peditto D, McIntosh RA, and Keller B. The powdery mildew resistance gene Pm8 derived from rye is suppressed by its wheat ortholog Pm3. Plant J. 2014; 79:904–913.
Mago R, Miah H, Lawrence GJ, Wellings CR, Spielmeyer W, Bariana HS, McIntosh RA, Pryor AJ, and Ellis JG. High-resolution mapping and mutation analysis separate the rust resistance genes Sr31, Lr26 and Yr9 on the short arm of rye chromosome 1. Theor. Appl. Genet. 2005; 112:41–50.
Pretorius ZA, Singh RP, Wagoire WW, and Payne TS. Detection of virulence to wheat stem rust resistance gene Sr31 in Puccinia graminis sp. tritici in Uganda. Plant Dis. 2000; 84:203.
Tang XL, Cao XR, Jiang YY, Luo Y, Ma ZH, Fan JR, and Zhou YL. Effects of climate change of on epidemics of powdery mildew in winter wheat in China. Plant Dis. 2017; 101:1753–1760.
Keller M, Keller B, Schachermayr G, Winzeler M, Schmid JE, Stamp P, Messmer MM. Quantitative trait loci for resistance against powdery mildew in a segregating wheat × spelt population. Theor. Appl. Genet. 1999; 98:903–912.
Liu ZY, Sun QX, Ni ZF, Nevo E, and Yang T. Molecular characterization of a novel powdery mildew resistance gene Pm30 in wheat originating from wild emmer. 2002; 123:21–29.
Wu XX, Xu XF, Ma DX, Chen RZ, Li TY, and Cao YY. Virulence structure and its genetic diversity analyses of Blumeria graminis sp. tritici isolates in China. BMC Evo. Bio. 2019; 19:183.
Li MJ, Duan XY, Zhou YL, Yu YX, Bi YQ, Yang JH, and Zhang Q. Postulation of seedlings resistance genes to powdery mildew in wheat commercial cultivars from Yunnan Province. J. Triticeae Crops. 2012; 32:551–556.
Li TY, Cao YY, Wu XX, Xu XF, and Wang WL. Seedling resistance to stem rust and molecular marker analysis of resistance genes in wheat cultivars of Yunnan, China. PLoS One. 2016; 11:e0165640.
Li MJ. Population genetic structure of Puccinia striiformis sp. tritici in Yunnan Province. Dr. thesis, Institute of plant protection, Chinese Academy of Agricultural Sciences, Beijing, 2013. http://en.cnki.com.cn/Article_en/CJFDTOTAL-MLZW20 1205013.htm
Xu XF, Li DD, Liu Y, Gao Y, Wang ZY, Ma YC, Yang S, Cao YY, Xuan YH, and Li TY. Evaluation and identification of stem rust resistance genes Sr2, Sr24, Sr25, Sr26, Sr31 and Sr38 in wheat lines from Gansu Province in China. Peer J. 2017; 5:e4146.
Tommasini L, Yahiaoui N, Srichumpa P, and Keller B. Development of functional markers specific for seven Pm3 resistance alleles and their validation in the bread wheat gene pool. Theor. Appl. Genet. 2006; 114:165–175.
Mohler V, Hsam SLK, Zeller FJ, and Wenzel G. An STS marker distinguishing the rye-derived powdery mildew resistance alleles at the Pm8/Pm17 locus of common wheat. Plant Breeding. 2001; 120:448–450.
Liu ZY, Sun QX, Ni ZF, and Yang TM. Development of SCAR markers linked to the Pm12 genes conferring resistance to powdery mildew in common wheat. Plant Breed. 1999; 118:215–219.
Chen XM, Luo YH, Xia XC, Xia LQ, Chen X, Ren ZH, and Jia JZ. Chromosomal location of powdery mildew resistance gene Pm16 in wheat using SSR marker analysis. Plant Breed. 2005; 124:225–228.
Zhu GQ, Chi WJ, Wu XX, and Cao YY. Analysis of genetic diversity and geographic relationship of Blumeria graminis sp. tritici in Northeastern wheat region. J. Henan Agri. Sci. 2015; 44:77–82.
Briggle LW, and Sears ER. Linkage of resistance to Erysiphe graminis sp. tritici (Pm3) and hairy glume (Hg) on chromosome 1A of wheat. Crop Sci. 1966; 6:559–561.
Bougot Y, Lemoine J, Pavoine MT, Barloy D, and Doussinault G. Identification of a microsatellite marker associated with Pm3 resistance alleles to powdery mildew in wheat. Plant Breed. 2002; 121:325–329.
Liu WL, Zhang HJ, Sun Y, Liu DJ, Yang SP, Zhang R, and Meng QL. Detection and analysis of resistance genes of spring wheat to powdery mildew in Heilongjiang Province since the founding of the People's Republic of China. Nuclear Agri. Sci. 2019; 33:39–47.
Graybosch RA. Uneasy unions: Quality effects of rye chromatin transfers to wheat. Cereal Sci. 2001; 33:3–16.
Li HJ, Wang XM, Song FJ, Wu CP, Wu XF, Zhang N, Zhou Y, and Zhang XY. Response to powdery mildew and detection of resistance genes in wheat cultivars from China. Acta Agronomica Sin. 2011; 37:943–954.
Cenci A, D’Ovidio R, Tanzarella OA, Ceoloni C, and Porceddu E. Identification of molecular markers linked to Pm13, an Aegilops longissima gene conferring resistance to powdery mildew in wheat. Theor. Appl. Genet. 1999; 98:448–454.
Li J, Wang JH, Ren MJ, and Xu RH. Identification and application of the special marker of Pm13 and Pm21 genes with resistance to powdery mildew in wheat. Guizhou Agri. Sci. 2009; 37:1–4.
Liu B, li SH, Wang YQ, and Hu DW. Molecular detection of powdery mildew resistance genes in the commercial wheat cultivars in China. Acta Phytophylacica sinica. 2010; 37:113–117.
Reader SM, and Miller TE. The introduction into breed wheat of a major gene for resistance to powdery mildew from wild emmer wheat. 1991; 53:57–60.
Wang J. Establishment of SSR molecular markers tightly linked to wheat powdery mildew resistance genes Pm12 and Pm16. Master's Thesis, China Agricultural University, Beijin, 2004. http://www.doc88.com/p-807989413173.html.
Zhao JH, Shang YF, Wang SJ, Yang CL, and Lu XB. Identification of mult-resistance of 152 wheat varieties (strains) in Huang Huai region. J. Triticeae Crops. 2007; 27:1123–1127.
Cao SQ, Luo HS, Jin MA, Zhang B, Huang J, Jin SL Jia QZ, Wang XM, Li H, and Zhang CJ. Occurrence characteristics and control strategies of wheat powdery mildew in Longnan wheat region of Gansu Province in 2010. Gansu Agri. Sci. Techno. 2011; 31:24–26.
Zhan HX, Chang ZJ, Yang ZJ, Zhang XJ, and Li X. Sources and evaluation of powdery mildew resistance Genes in Wheat. Chinese Agri. Sci. Bulletin 2010; 26:42–46.
Jiang Z, Wang QL, Wu JH, Xue WB, Zeng QD, Huang LL Kang ZS, and Hang DJ. Distribution of powdery mildew resistance gene Pm21 in Chinese winter wheat cultivars and breeding lines based on gene-specific marker. Scientia Agri. Sinica. 2014; 47:2078–2087.
Xiang QJ, Sheng BQ, Zhong YL, Duan XY, and Zhang KC. Analyses of resistance genes of three differential varieties to the isolates of Blumeria graminis sp. tritici in wheat. Acta Agric. Boreali-Sin. 1994; 9:94–97.
Si MQ, Zhang XX, Duan XY, and Sheng BQ. Identification of physiologic race of Erysiphe graminis sp. tritici. Scientia Agri. Sinica. 1987; 20:64–70.

Table 1 Percentagess of susceptible and resistant wheat cultivars to six isolates of Blumeria graminis f. sp. tritici.

Isolates	Susceptible			Resistance
	Number of cultivras	Percentage (%)	Number of cultivras		Percentage (%)
09558-1	61	88.4	8		11.6
W1	46	66.7	23		33.3
W12	54	78.3	15		21.7
L14	54	78.3	15		21.7
T7	56	81.2	13		18.8
H1-5-1	61	88.4	8		11.6
All tested isolates	65	94.2	4		5.8

Table 2 Seedling infection types to Blumeria graminis f.sp. tritici and resistance genes detected with molecular markers

Cultivar/line	Infection types^a							Resistance gene
Cultivar/line	09558-1	W1	W12	L14	T7	H1-5-1	*Pm3*		*Pm8*	*Pm13*	*Pm16*	*Pm21*
017-10	4	3	4	3	3	4	-		-	-	-	-
02D2-282	4	4	4	4	4	4	-		-	-	-	-
06D6-6	4	4	4	4	4	3	-		-	-	-	-
91E001	4	3	3	4	3	4	-		-	-	-	-
Chumai 12	3	4	3	4	4	4	-		-	-	-	-
De 4-8	0	0	0;	0	0;	0	-		-	-	-	+
De 05-81	3	4	4	3	4	3	-		+	-	-	-
De 08-3	2	0	0	1	0;	0	-		-	-	-	-
Demai 3	4	3	4	3	3	3	-		-	-	-	-
Demai 4	3	3	4	4	4	4	-		+	-	-	-
Demai 5	4	4	4	3	3	4	-		-	-	-	-
Demai 7	4	4	4	4	4	4	-		+	-	-	-
E33	4	3	4	4	3	3	-		+	-	-	-
Feng 05-394	4	3	4	4	3	4	-		-	-	-	-
Feng 1124	3	2	3	0	3	3	-		-	-	+	-
Fengmai 13	4	3	4	3	4	4	-		-	-	-	-
Fengmai 24	4	4	4	4	4	4	-		-	-	-	-
Fengmai 34	3	3	4	4	4	4	-		-	-	-	-
Fengmai 35	4	2	0	3	3	3	+		-	-	-	-
Fengmai 36	4	3	4	4	3	3	-		-	-	-	-
Fengmai 37	4	0	2	3	0	3	-		-	-	-	-
Fengmai 38	4	0;	0	4	3	4	-		-	-	-	-
Fengmai 39	4	3	4	2	4	3	-		-	-	-	-
Fengyin 03-2	4	2	4	2	3	4	-		-	-	+	-
Jing 0202	3	2	3	4	0	4	+		+	-	-	-
Jing 06-4	3	3	4	3	4	4	-		+	-	-	-
Jingmai 11	4	0	0;	3	4	3	-		+	-	-	-
Jingmai 12	4	3	4	4	3	4	-		+	-	-	-
Jingmai 14	4	4	3	4	4	4	-		+	-	-	-
Kun 022-222-1	4	4	3	3	4	4	-		-	-	-	-
Kunmai 4	0	0;	0	1	0	1	-		-	-	-	+
Kunmai 5	4	3	0	0;	4	4	-		+	-	-	-
Liangmai 4	4	2	4	1	3	3	+		+	-	-	-
Linmai 15	3	4	4	4	3	4	-		+	-	-	-
Linmai 6	4	4	3	4	4	4	-		-	-	-	-
Mentana	3	3	4	3	3	3	-		-	-	-	-
Mian 1971-98	4	0;	3	4	4	3	-		-	-	-	-
Mianyang 19	3	3	4	3	4	4	-		-	-	-	-
Mianyang 20	4	4	3	4	4	4	-		-	-	-	-
Nanyuan 1	4	3	3	4	3	4	-		-	-	-	-
R101	3	4	3	3	3	3	-		-	-	-	-
R57	4	0	4	3	2	4	-		+	-	-	-
Wenmai 11	4	0;	4	3	1	4	+		+	-	-	-
Wenmai 12	4	3	1	2	4	3	-		+	-	-	-
Yimai 1	4	4	4	4	4	4	-		-	-	-	-
Yimai 10	3	4	4	4	4	4	-		-	-	-	-
Yimai lines 2003-13	1	0	1	0;	1	1	-		-	-	-	-
Yimai lines 2003-27	0	1	1	0;	1	0;	-		-	-	-	-
Yixi 2003-64	0;	0	1	0;	1	0	-		-	-	-	+
Yumai 1	4	4	4	4	4	4	-		+	-	-	-
Yumai 3	3	2	4	3	3	4	+		+	-	-	-
Yunmai 101	3	4	3	3	4	4	-		+	-	-	-
Yunmai 11-12	4	3	4	4	3	4	-		-	-	-	-
Yunmai 29	4	3	4	3	4	4	-		-	-	-	-
Yunmai 39	3	3	2	3	4	4	-		-	-	+	-
Yunmai 42	3	3	4	3	3	4	-		-	-	+	-
Yunmai 43	4	4	3	3	4	1	-		-	-	-	-
Yunmai 47	3	4	4	4	3	3	-		-	-	-	-
Yunmai 48	2	4	3	0	4	4	-		-	-	-	-
Yunmai 51	4	0;	4	3	3	3	+		-	-	-	-
Yunmai 52	4	4	3	4	3	4	-		-	-	-	-
Yunmai 53	3	2	3	0	0;	1	-		-	-	-	-
Yunmai 54	4	3	4	4	3	4	-		-	-	-	-
Yunmai 56	3	0	0	4	1	3	-		-	-	-	-
Yunmai 57	4	4	0	3	0;	4	-		-	-	-	-
Yunxuan 3	4	3	3	4	4	4	-		-	-	-	-
Yunza 5	4	4	3	3	3	3	-		-	-	-	-
Yunza 6	4	4	4	3	4	3	-		-	-	-	-
Yunza 7	4	3	4	4	3	4	-		-	-	-	-

Table 3 Pedigrees of 69 wheat cultivars used in this study

Cultivar/line		Pedigree	Cultivar/line			Pedigree
017-10	Bolsena-1CH/[SieteCerros/XBVT223//AWX011.G.48.2/XBVT221]		Mianyang 19	Selected form Fan 6/70-5858 with systemic selection
02D2-282	Yunmai 39/Yunmai 42		Mentana	Reiti /Wilhelmina// Akagomughi
06D6-6	Yumai 39/992-3		Mian1971-98		96-18-6/92R178
91E001	Selected from Mexico wheat		Yunmai 43	Unkonw
Chumai 12	Selected from the observation materials of 02d-195 with systemic selection		Mianyang 20	Selected form 70-5858/ Fan 6 with systemic selection
De 4-8	Unknow		Nanyuan 1	Mentana /Yuannong 1
De 05-81	9213-194/9213-4074		R101	AGA/HORK“S”
De 08-3	Unkown		R57	Selected from Mexico wheat
Wenmai 12	Selected from the hybrid advanced lines of ‘0581-1’ with systemic selection		Wenmai 11	Selected from the hybrid advanced lines of ‘0581-39’ with systemic selection
Demai 3	Longchun 2/Mocha		Demai 4	782-88/Zhongyin 1022
Demai 5	Mianyang 11/Yun 80-1		Yimai 1	Unknow
Yimai lines 2003-13	Chuanmai 24/96-16		Yimai 10	Selected from Yimai 1 with systemic selection
Demai 7	Yunzhi 437/892- 17		E33	Selected from Mexico wheat
Feng 05-394	Selected from Fengmai 31’s with single systemic selection		Yimai lines 2003-27	96-23/96-14
Feng 1124	E33/58769-6		Yixi 2003-64	96-23/96-14
Fengmai 13	Unknow		Yumai 1	Xingaibai/Germanic dunmai
Fengmai 24	Moba 65/Precocious Ajin/Mosha F₆/ 750025-12/ Mexico advanced lines 965		Fengmai 36	Selected from Fengmai 31’s with single systemic selection
Yunmai 29	Zhushi Wheat/Fuli Wheat		Yumai 3	82-1/8334
Fengmai 34	9034M3-2-2/YV91-1167		Yunmai 101	963-8224/98042-7
Fengmai 35	Fengmai 24//806-14-2-15/85-7421 F1		Yunmai 11-12	NG8319//SHA4/LTRA
Fengmai 37	9034M8-17/Fengmai 24		Yunmai 39	Zhushi Wheat/Fuli Wheat/Fticher’s
Fengmai 38	Momai Lines 91E001/Advanced lines 8941		Yunmai 42	Kangxiu 782/Yunmai 29//YKLO-PAM S
Fengmai 39	Selected from Fengmai 31’s with single systemic selection		Yunxuan 3	SW84882/4/SIN/TRAP#1/3/KAUZ2/TRAP//KAUZ
Jingmai 11	Kavkaz 78-385/Mo 980// Multiparent mixed pollen		Yunmai 47	852-18/852-181//86-4437-75/3/822-852/785//842-929/4/Gangu 436/5/923-3763
Jing 0202	Jingmia 10/96 Feng 1		Yunmai 48	48 99213/92B-4074
Jing 06-4	849M₂-11-23/7730-1-149		Yunmai 51	91B-831/92B-84
Fengyin 03-2	Unknow		Yunmai 52	92R149/963-11185
Jingmai 12	7901/792364//9118		Yunmai 53	96B-254/96B-6
Jingmai 14	Sumai 3/Qing 30// 8619-10		Yunmai 54	Yunmai 39/S-792
Kun 022-222-1	Selected from the advanced lines 022-222 with systemic selection		Yunmai 56	Advanced lines 932-625/Advanced lines 822-16-7-3
Kunmai 4	Selected from the kunmai 2 with systemic selection		Yunmai 57	Screening wheat materials from CIMMYT
Kunmai 5	992-17/Huelauen		Yunza 5	01Y1-1069/ K78S
Liangmai 4	N1491/N1071		Yunza 6	K78S/01Y1-608
Linmai 15	A122/（87-5/E232）		Yunza 7	K78S/02Y1-101
Linmai 6	86 Jian 22/84-346

Table 4 Infection types of 37 wheat genotypeswith known Pm genes to tested isolates of Blumaria graminis f. sp. tritici

Genotype	Pm gene	Infection types to B. graminis f.sp. tritici isolates^a
Genotype	Pm gene	09558-1	W1	W12	L14	T7	H1-5-1
Aminster/8cc	Pm1	4	0	3	4	4	3
Ulka/8cc	Pm2	4	3	4	0	3	4
Asonsan/8cc	Pm3a	4	0	3	4	4	3
Chul/8cc	Pm3b	4	0	3	3	4	0
Sonora/8cc	Pm3c	4	3	4	4	4	3
Kolibri	Pm3d	4	0	1	1	4	4
W150	Pm3e	4	0	4	3	4	4
Mich.Amber/8cc	Pm3f	4	4	4	2	4	4
Whapli/8cc	Pm4a	4	1	3	1	4	4
Armada	Pm4b	4	3	4	3	4	4
Hope/8cc	Pm5	4	1	4	1	4	3
Coker983	Pm5+6	4	2	0	4	0	3
Tingalen	Pm6	4	3	1	2	3	2
Coker747	Pm6	4	3	3	3	4	3
CI14189	Pm7	4	0;	1	3	4	4
Kavkaz	Pm8	4	3	3	2	0	0;
Kenguia	Pm4+8	4	3	4	3	4	3
Nnormandie	Pm1+2+9	4	3	1	3	4	4
R4A	Pm13	0;	1	0	0	0;	1
Brigand	Pm16	3	0	3	1	3	4
MIN	Pm18	0	1	2	0	0	1
KS93WGRC28	Pm20	4	3	3	3	4	3
Yangmai 5/sub.6v	Pm21	0	0	0	0	0	1
Virest	Pm22	0	0	4	1	0	2
line81-7241	Pm23	4	0;	3	1	4	3
Chiyacao	Pm24	4	3	3	0	4	3
5P27	Pm30	4	3	4	1	4	4
Mission	Pm4b+mli	4	3	4	0	4	4
Maris Dire	Pm2+mld	3	1	4	0	0	3
Xiaobaidongmai	PmXBD	4	1	4	0	1	1
Baimian 3	Pm4+8	3	1	3	0	4	4
CI12632	Pm4+8	4	1	4	0	4	3
Marishuntsman	Pm2 + 6 + ?	3	4	3	4	1	3
Era	-	4	3	4	0	0	2
Amigo	Pm17	4	1	1	3	4	4
XX186	Pm19	4	3	4	3	4	4
Funo	-	4	4	4	3	4	4

^aInfection types: 0 = no visible symptoms; 0; = hypersensitive necrotic flecks; 1 = minute colonies with few conidia; 2 = colonies with moderately developed hyphae, but few conidia; 3 = colonies with well-developed hyphae and abundant conidia, but colonies not joined together; and 4 = colonies with welldeveloped hyphae and abundant conidia, and colonies mostly joined together.

Table 5 Molecular markers linked to resistance genes Pm3, Pm8, Pm13, Pm6, and Pm21 with their forward and backward primers

Tagged Pm gene	Primer	Fragment size (bp)	Primer sequence (5’ – 3’)
Pm3	Pm3a	624	gga gtc tct tcg cat aga cag ctt cta aga tca agg at
Pm8	IAG95	1050	AGCAACCAAACACACCCATC ATACTACGAACACACACCCC
Pm13	UTV14F/R	517	CGCCAGCCAATTATCTCCATGA AGCCATGCGCGGTGTCATGTGAA
Pm16	Xgwm159	201	GGGCCAACACTGGAACAC GCAGAAGCTTGTTGGTAGGC
Pm21	Scar1265	1265	CACTCTCCTCCACTAACAGAGG GTTTGTTCACGTTGAATGAATC

Evaluation of resistance to powdery mildew and identification of resistance genes in wheat cultivars

Status:

Version 1

Abstract

Figures

Background

Results

Discussion

Conclusions

Methods

Abbreviations

Declarations

References

Tables

Status:

Version 1