Cells and reagents
BCPAP and KTC-1 cells were purchased from the national collection of authenticated cell cultures. BCPAP, TPC-1, K1, and Nthy-ori 3 − 1 cells were purchased from Shanghai Qida Biotechnology Co., Ltd. BCPAP, KTC-1, TPC-1, and Nthy-ori 3 − 1 cells were cultured in RPMI 1640 medium (Gibco, Carlsbad, CA, USA) with 10% fetal bovine serum (FBS; Gibco). K1 cells were cultured in Leibovitz's L-15 (Gibco). All cells were tested for mycoplasma contamination and had no mycoplasma contamination. Antibodies are as follows: SIRT5 (catalog #15122-1-AP, Proteintech, Rosemont, IL, USA), HA (catalog #H9658, Sigma‒Aldrich), Flag M2 (catalog #F1804, Sigma‒Aldrich), Ki67 (catalog #ab16667, Abcam, Cambridge, MA, USA), β-actin (catalog #4970, Cell Signaling Technology, Boston, MA, USA), anti-pan-acetyl-lysine (catalog #9681, Cell Signaling Technology), anti-pan-succinylation (catalog #PTM-401, PTM Biolabs, Hangzhou, China), anti-pan-glutarylation (catalog #PTM-1151, PTM Biolabs), and anti-pan-malonylation (catalog #PTM-901, PTM Biolabs). Antibodies specifically recognizing succinylation at lysine-155 of LDHA were prepared commercially at ChinaPeptides Co., Ltd. (Shanghai, China). The synthesized peptide ISGFP(Suc) NRVIGSGCN was coupled to KLH as an antigen to immunize rabbits. Antiserum was collected after four doses of immunization. All cells were tested for mycoplasma contamination and had no mycoplasma contamination.
GLTC, GLTC-MUT, Flag-SIRT5, HA-LDHAWT, HA-LDHAK155E, HA-LDHAK155R and empty vector were subcloned into the expression vector pcDNA3.1 (Invitrogen, USA). Small interfering RNAs (siRNAs) against human GLTC, LDHA, and SIRT5 were transfected into DTC cells using Lipofectamine 2000 transfection reagent (Invitrogen, Waltham, MA, USA). All the siRNAs and the plasmids were transfected into DTC cells using Lipofectamine 2000 transfection reagent (Invitrogen, Waltham, MA, USA). Sh-GLTC and sh-NC lentiviruses were constructed into TPC-1 and TPC-1/IR cell lines. GLTC overexpression lentivirus was constructed into K1 cells. All plasmids, siRNAs and lentiviruses were purchased from Genepharma Technology (Shanghai, China). The sequences of the siRNA are listed in Supplementary Table 1.
Clinical samples
Tumors and adjacent thyroid tissues were obtained from patients with metastatic thyroid cancer who underwent surgery at Affiliated Hospital of Jiangsu University and Nanjing First Hospital. The study protocol was approved by the ethics committee of Affiliated Hospital of Jiangsu University, School of Medicine, Jiangsu University (Zhenjiang, China) and Nanjing First Hospital, Nanjing Medical University (Nanjing, China). Written informed consent was obtained from all participants in this study. All the research was carried out in accordance with the provisions of the Declaration of Helsinki of 1975. None of these patients had received any treatment prior to surgery.
RNA extraction and qRT‒PCR
Total RNA was isolated by TRIzol reagent (Omega, Norcross, GA, USA) and transcribed to cDNA using a cDNA synthesis kit (Vazyme, Nanjing, China) according to the manufacturer’s protocol. Quantitative real-time PCR performed with gene-specific primers was carried out by using SYBR Green PCR Master Mix (TaKaRa, Shiga, Japan). The transcript levels of the genes were detected by the StepOnePlus Real-Time PCR System (Applied Biosystems, Waltham, MA, USA). The gene-specific primers are listed in Supplementary Table 1.
Subcellular fractionation
A PARIS™ Kit (Ambion, Austin, TX) was used for the separation of cytoplasmic and nuclear RNA. RNA extracted from the cytoplasmic and nuclear fractions was further analyzed by qPCR. β-actin was used as a cytoplasmic marker, and U6 was used as a nuclear marker.
Western blot analysis
Cells were lysed in RIPA buffer solution containing protease inhibitors by incubating for 30 min on ice and then centrifuged at 15,000×g for 30 min at 4°C. Samples were boiled and then analyzed by western blot analysis as previously described [15].
LDHA activity assay
HA-tagged LDHAWT/K155E/K155R protein was immunopurified from transfected cells, and LDHA activity was determined using an LDH Activity Assay kit according to the manufacturer’s instructions (Nanjing Jiancheng Bioengineering Institute, Nanjing, China).
In vitro 18F-FDG uptake, lactate production, and NAD+/NADH ratio assays
Cells were collected and washed three times with cold phosphate-buffered saline (PBS). Then, the collected cells were incubated in 1 mL of glucose-free culture medium containing 18F-FDG (111 kBq [3 µCi/mL]) for 1 h at 37°C. The cells were washed three times with cold PBS. One milliliter of 0.1 M NaOH was added per well to produce lysates. The radioactivity of the lysates was detected by a well γ-counter. The data were normalized to the cell number. For the lactate production measurements, the cells were washed with PBS and cultured in glucose-free culture medium for 12 h. The cells or tissues were lysed and centrifuged at 4°C for 30 min. Then, the clear supernatants were collected to measure the lactate levels according to the instructions of the Lactate Assay Kit (CMA, Sweden). An NAD+/NADH Quantitation Kit (Njjcbio, China) was used to quantify the NAD+/NADH ratio in cell lysates. The data were normalized to the cell number. Three independent experiments were performed during our study.
Cell proliferation and colony formation assay
Cell proliferation was assessed by the Cell Counting Kit-8 (Dojindo, Japan). A total of 5 × 103 cells were seeded in a 96-well plate. CCK-8 (10 µl/well) was added to each well. After incubation for 1 h, the optical density at 450 nm (OD450) was measured for each sample.
For the plate colony formation assay, 300 cells per well were seeded in a 6-well plate. The medium was changed regularly. After culture for 14 days, cell colonies were stained with 0.1% crystal violet (1 mg/mL) and counted.
XF24 extracellular flux analysis
An XF24 extracellular flux analyzer was used to evaluate the extracellular acidification rate (ECAR). In total, 2×104 cells were plated in XF24 cell culture plates (Seahorse Bioscience, USA) and incubated at 37°C overnight. The ECAR was measured using a Seahorse XF Glycolysis Stress Test kit (Agilent Technologies). The values are presented as the means ± standard errors of the means.
The 6-14C-Glucose CO2 Release Assay
The cells were cultured in glucose-free culture medium with 0.1 µCi/mL 6-14C glucose and incubated in a sealed chamber. The sealed chamber was placed in a 37°C CO2-free cell incubator for 1 hour. Then, the cells were treated with 500 µl of 1 M H2SO4. A centrifuge containing 1 mL of CO2 adsorbent phenylethylamine was placed in the seal chamber. The sealed chamber was then placed in a CO2-free cell incubator at 37°C for 1 hour. The radiolabeled CO2 released from the cells was captured by phenylethylamine and measured with a scintillation counter.
Xenograft mouse model and 18F-FDG micro-PET/CT
TPC-1 cells (1.0 × 107) stably expressing shcon or shGLTC were injected subcutaneously into four-week-old female BALB/c nude mice. Mice were subjected to 18F-FDG PET scans 21 days after injection. Mice were administered 18F-FDG (250 µCi for each mouse) by tail vein injection after fasting for 6 h. Forty-five minutes later, the animals were anesthetized with 2.5% isoflurane and immobilized during 10 min PET scan acquisition (Inveon, Siemens). The regions of interest, which covered the entire tumor, were drawn around the tumors on CT scan slices. The maximal standard uptake values were calculated to assess the 18F-FDG uptake ability of tumors. After PET/CT scanning, the mice were sacrificed, and the tumors were excised and weighed.
LDHA-KO-K1 (1.0×107) cells stably expressing control or GLTC-overexpressing plasmid and HA-LDHAWT/K155R/K155E were injected subcutaneously into four-week-old female BALB/c nude mice. All mice were killed at 21 days after injection, and tumor tissues were collected and weighed.
TPC-1 or 131I-resistant TPC-1 cells (1×107) stably expressing shcon or shGLTC were subcutaneously inoculated into four-week-old female BALB/c nude mice. Fourteen days after subcutaneous inoculation, mice were randomly divided into different groups and intratumorally injected with 131I (2.8 mCi in 100 µl) or saline as a control group. After 3 weeks of treatment, the mice were sacrificed, and the tumor weight was measured.
Immunoprecipitation
For analysis of endogenous protein–protein interactions, whole lysates were incubated with antibody against SIRT5 or LDHA and 20 µL of protein A/G agarose (Pierce, Waltham, MA, USA) overnight at 4°C. For the exogenous co-IP assay, cell lysates containing HA-tagged or Flag-tagged proteins were incubated with anti-HA agarose (Sigma-Aldrich) or anti-Flag (Sigma‒Aldrich) affinity gel overnight at 4°C. Then, sample loading buffer was added to the agarose and boiled. The resulting samples were detected by western blotting.
RNA immunoprecipitation (RIP) assay
RIP experiments were performed using a magna RNA-binding protein immunoprecipitation kit (Millipore, Bedford, MA, USA) according to the instructions. The cell lysates containing a protease inhibitor cocktail and RNase inhibitor were incubated with RIP buffer containing magnetic beads conjugated with human anti-LDHA antibody (Proteintech) or negative control IgG. The coprecipitated RNAs were subjected to real-time PCR to demonstrate the presence of the binding targets. Total RNA and IgG controls were simultaneously assayed to demonstrate that the detected RNA signals specifically bind to LDHA.
In situ hybridization
In situ detection of GLTC was performed in paraffin-embedded samples using a DIG-labeled miRCURYTM Detection probe (Exiqon). The probe sequence of GLTC is listed as follows: 5′–3′/5DigN/AGTTGAGCATCTCGTCGCCATTAC/3Dig_N/. Briefly, the sections were hybridized with the probe complementary to GLTC overnight at 40°C. Then, the sections were incubated with anti-DIG-AP Fab fragments for 60 min at 37°C, followed by conjugation with alkaline phosphatase for 30 min at 37°C. Nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate color substrate (NBT-BCIP; Roche) was used to detect the signals of hybridized probes. A purple stain in the samples indicated a positive signal by NBT-BCIP. A brown precipitate in the samples indicated a positive signal.
RNA pulldown
LncRNA was reverse transcribed by a MEGAscript T7 Transcription Kit (Thermo Fisher Scientific) and biotinylated with a Pierce RNA 3' End Desthiobiotinylation Kit (Thermo Fisher Scientific) according to the manufacturers’ instructions. DTC cells were collected and lysed in Pierce IP lysis buffer (Thermo Scientific). RNA pulldown assays were performed using a Pierce Magnetic RNA–Protein Pull Down Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. Streptavidin magnetic beads were used to capture the biotinylated RNA, and the biotinylated nucleic acid compounds were then incubated with cell lysates or purified protein (20 µg) at 4°C for 3 h. The proteins were eluted from the RBP complex and subjected to MS analysis or western blotting.
CRISPR–Cas9-LDHA knockout cell line
For generation of K1 LDHA knockout (KO) cell lines, the sgRNA sequences (Supplementary Table 1) were ligated into the LentiCRISPRv2 plasmid. HEK293T cells were transiently transfected with LentiCRISPRv2 plasmid and viral packaging plasmids (psPAX2 and pMD2G). Forty-eight hours later, viral supernatant was harvested and filtered through a 0.45 µm strainer. K1 cells were infected with the lentiviruses. Selection was carried out with puromycin (1 µg/mL) for 1 week. Infected cells were seeded as single cells (monoclonal cultivation) to obtain knockout cell lines verified by western blotting.
Fluorescence in situ hybridization
Fluorescence in situ hybridization (FISH) analysis was performed with a lncRNA FISH Kit (RiboBio, Guangzhou, China) according to the manufacturer’s instructions. Briefly, DTC cells were grown in 24-well plates on glass coverslips. Cells were harvested, washed with PBS and fixed using 4% paraformaldehyde for 10 min. After permeabilization with 0.25% Triton X-100 for 10 min, the cells were washed with PBS and hybridized with FISH probes designed by RiboBio (Guangzhou, China) overnight in a humidified chamber at 37°C in the dark. All images were obtained with a confocal laser-scanning microscope (Zeiss, Oberkochen, Germany).
Immunohistochemistry
For the immunohistochemistry assays, staining and analysis were performed and measured as reported previously [15].
LC‒MS/MS analysis of peptide succinylation
GLTC-transfected DTC cell lysates were lysed in urea (8 M urea, 100 mM Tris/HCl, pH 8.5) buffer, and protein was extracted. The Bradford Protein Assay Kit was used to quantify the amount of protein. A total of 20 µg of protein from each sample was mixed with 5X loading buffer and boiled for 5 min. The samples were subjected to 12.5% SDS‒PAGE electrophoresis followed by Coomassie Blue R-250 staining. Then, DTT (with a final concentration of 10 mM) was added to the samples, mixed at 600 rpm for 1.5 h (37 ℃), and then cooled to room temperature. IAA at a final concentration of 50 mM was added to the mixture, and the mixture was incubated in the dark for 30 min. A 4-fold volume of 50 mM Tris HCl (pH 8.0) was used to dilute the concentrate to 2 M. The samples were digested with trypsin (trypsin:protein (wt/wt) ratio, 1:50) at 37°C overnight. The peptides were eluted from the beads with 0.1% TFA and were then combined and vacuum-dried. The obtained peptides were cleaned with C18 Cartridges (Empore™ SPE Cartridges C18 (standard density), bed I.D. 7 mm, volume 3 ml, Sigma) and lyophilized for further use.
The samples were dissolved in 1.4 mL of precooled IAP Buffer and then incubated with pretreated anti-succinyl-lysine antibody beads (PTMScan® Succinyl-Lysine Motif Kit, Cell Signaling Technology) at 4°C with gentle shaking for 1.5 h and centrifuged at 2,000 ×g for 30 s. Then, the supernatant was discarded. Anti-succinyl-lysine antibody beads were washed with 1 mL of precooled IAP buffer 3 times and then washed with precooled water 3 times. The peptides were eluted from the beads with 40 µL of 0.1% TFA and were then combined and vacuum-dried at room temperature. The peptides were added to 0.1% TFA again and centrifuged at 2,000 ×g for 30 s. The supernatant containing immune-enriched succinylated peptides was desalted by C18 STAGE Tips.
LC‒MS/MS analysis was performed on a Q Exactive HF/HFX mass spectrometer (Thermo Scientific) coupled to Easy nLC (Proxeon Biosystems, now Thermo Fisher Scientific) for 120 min. The samples were loaded onto a reversed-phase trap column (Thermo Scientific Acclaim PepMap100, 100 µm*2 cm, nanoViper C18) connected to a C18 reversed-phase analytical column (Thermo Scientific Easy Column, 10 cm long, 75 µm inner diameter, 3 µm resin) in buffer A (0.1% formic acid) and eluted with a linear gradient of buffer B from 5% solvent B (90% acetonitrile/0.1% formic acid, v/v) to 80% solvent B for 40 min at a flow rate of 300 nL/min. The mass spectrometer was operated in positive ion mode. MS data were acquired using a data-dependent top10 method dynamically choosing the most abundant precursor ions from the survey scan (300–1800 m/z) for higher energy C-trap dissociation fragmentation. The automatic gain control (AGC) target was set to 3e6, and the maximum inject time was set to 10 ms. The dynamic exclusion duration was set to 5 s. Survey scans were acquired at a mass resolution of 70,000 at m/z = 200, the resolution for HCD spectra was set to 17,500 at m/z = 200, and the isolation width was 2 m/z. The normalized collision energy was 30 eV, and the underfill ratio, which specifies the minimum percentage of the target value likely to be reached at maximum fill time, was defined as 0.1%. The instrument was run with peptide recognition mode enabled. All MS/MS data obtained from LC‒MS/MS were combined and searched using MaxQuant software (version 1.3.0.5) for identification and quantitation analysis.
Statistical Analysis
Statistical analysis was performed using GraphPad Prism 5 (GraphPad Software, San Diego, CA, USA) or SPSS 18.0 software (SPSS, Chicago, Ill, USA). All data are presented as the means ± SEMs. A two-tailed unpaired Student’s t test was used to analyze the difference between two groups. One-way analysis of variance was used to analyze the difference among three or more groups. For the clinicopathologic analysis, the χ2 test and Pearson’s correlation were performed. The survival curves were calculated using the Kaplan‒Meier method, and the differences were assessed by a log-rank test. Univariate and multivariate Cox regression analyses were used to determine the factors that influenced survival. P < 0.05 was considered statistically significant.