In this study, two combined processes of coagulation sedimentation-NaClO disinfection and coagulation sedimentation-Ultrafiltration(UF)-NaClO disinfection were used as deep treatment processes. To explore the removal effect and mechanism of the combined process on Legionella, Pseudomonas aeruginosa, Mycobacterium avium and Escherichia coli in the secondary effluent. Taking Beijing Olympic Forest Park as the evaluation scene of reclaimed water landscape reuse, the health risk assessment were carried out on the opportunistic pathogens. The results showed that the combined process of coagulation sedimentation-UF-NaClO had a good removal effect on Legionella, Pseudomonas aeruginosa, Mycobacterium avium and Escherichia coli, the removal rates were 99.8%, 98.6%, 99.4% and 99.1%, respectively. There was a significant positive correlation between the concentration of Escherichia coli in the secondary effluent and the three opportunistic pathogens, but the correlation between the concentration of Escherichia coli in the effluent and the three opportunistic pathogens was no longer significant after the two combination processes. After secondary effluent coagulation and sedimentation-UF-NaClO disinfection and reuse for urban landscape leisure activities, the single exposure infection probability of the three opportunistic pathogens is the lowest, and the safety rate of human health can reach from 70.9–100.0%.
Research Article
Health risk assessment and removal efficiency of typical opportunistic pathogens by advanced reclaimed water treatment process
https://doi.org/10.21203/rs.3.rs-1950860/v1
This work is licensed under a CC BY 4.0 License
Version 1
posted
You are reading this latest preprint version
Reclaimed water
Opportunistic pathogens
Ultrafiltration
Risk assessment
Monte-Carlo
The microbiological safety of reclaimed water is beginning to receive attention as the pace of reuse of reclaimed water in China's cities continues to increase. Opportunistic pathogens (OPs), a group of pathogenic microorganisms, have received much attention as they can come into contact with the public through the water environment as a vector and thus cause epidemic diseases.
The secondary effluent of a wastewater plant can be effectively treated to remove organic matter and pathogenic microorganisms from the water. UF can effectively retain organic matter and E. coli in the water. Li (Li, 2021) found that UF was effective in removing Total Organic Carbon (TOC) and fecal coliforms from secondary effluent of a Hong Kong wastewater treatment plant, with removal rates of 88.9% and 100.0% respectively. Disinfection technology also has good inactivation effect on pathogenic microorganisms such as bacteria and viruses in water. After comparing the effectiveness of two disinfectants (ClO2 and Cl2) on secondary effluent, Fu (Fu et al., 2021) found that ClO2 disinfection treatment at appropriate doses was able to significantly reduce the microbiological safety risk in reclaimed water. However, the effectiveness of both techniques on the removal of opportunistic pathogens has been little studied both domestically and internationally.
In addition, some studies have shown that the pathogenic microorganisms that may be present in the exposure scenarios of secondary effluent water after deep treatment for reuse as reclaimed water can still pose a risk to human health. For example, Ma (Ma et al., 2015) summarized the results of research on the safety of pathogenic microorganisms in the process of using reclaimed water for greenfield irrigation. Dou (Dou et al., 2018) used quantitative microbial risk assessment (QMRA) to evaluate the health risks of fecal coliforms reuse in urban reclaimed water for flotation. Zhang (Zhang et al., 2022) evaluated the health risks of adenovirus (AdV), enterovirus (EV), and rotavirus (RV) in reclaimed water from three municipal wastewater treatment plants in Qingdao to occupational and non-occupational workers. However, there are few studies on the possible health risks caused by opportunistic pathogens in China, so there is a need to evaluate the risks they pose during the reuse of reclaimed water.
In this study, two combined processes of coagulation sedimentation-NaClO disinfection and coagulation sedimentation-UF-NaClO disinfection were selected for the deep treatment of secondary effluent, and the efficacy and mechanism of the two combined processes and each treatment unit on the removal of opportunistic pathogens (Legionella, Pseudomonas aeruginosa, Mycobacterium avium) and Escherichia coli were investigated. A Monte-Carlo simulation of the health risks of different pathogenic bacteria in the effluent of each process was carried out to evaluate the microbiological safety of the two processes, with a view to determining reasonable risk control targets and priority control strategies for pathogenic bacteria.
2.1 Experimental materials
The raw water for the test was a simulated secondary effluent from a sewage plant. The configuration was as follows: the school wastewater was taken and filtered through three pore sizes (1 mm, 70 µm and 40 µm) in order to remove the larger particulate matter from the wastewater, and then diluted 10 times with tap water (dechlorinated by 72h exposure). The raw water quality indicators are shown in Table 1.
|
pH |
Temperature/℃ |
Turbidity/NTU |
CODCr /mg·L− 1 |
|---|---|---|---|
|
7.75 |
24.2 |
6.85 |
20.0 |
The coagulant used in the coagulation test was Polyaluminium chloride (PACl), purchased from Shanghai Maclean Biochemical Technology Co., Ltd. The membrane used for the ultrafiltration test was a Regenerated cellulose (RC) plate ultrafiltration membrane manufactured by Merck, Darmstadt, Germany, with an effective membrane area of 46.8 cm2.
Preparation of sodium hypochlorite (NaClO) solution (effective chlorine content 1 g/L): 1 mL of analytically pure NaClO solution was fixed to 100 ml with pure water and then placed in a brown bottle and stored away from light. During the test, 1000 mL of water sample was placed in a beaker, 8 mL of the configured NaClO solution was added and the reaction was left to react for 0.5 h after contact.
2.2 Experimental setup
The coagulation test was carried out using a coagulation test mixer (ZR4-6 type, Shenzhen Zhongrun Water Industry Technology Development Co., Ltd., China). To determine the coagulant dosage, 1000 mL of simulated secondary effluent was added to each of the five beakers, then placed on the coagulation mixer and started pre-stirring (300 r/min) for 30 seconds to mix the water samples evenly, then PACl (dosage of 10, 30, 60, 90 and 120 mg/L) was added separately, and after the dosage was completed, fast stirring (200 r/min) for 3 min and slow stirring (50 r/min) for 30 min were used. After 30 minutes of standing, the supernatant of the sunken water was taken and the chemical oxygen demand (CODcr) and turbidity indexes were measured. During the test, the supernatant was filtered through a 100 KDa ultrafiltration membrane.
The ultrafiltration test was carried out using a low-pressure plate membrane experimental equipment (Model TYLG-18, Shandong Bona Biotechnology Group Co., Ltd., China). During filtration, the constant trans-membrane differential pressure was adjusted to 0.10 MPa. The coagulation sedimentation supernatant was passed through the reservoir, the ultrafiltration membrane filter layer was placed face down at the bottom of the permeate irrigation for water sample filtration, and the membrane effluent was collected in a beaker.
2.3 Instruments and analytical methods
2.3.1 General water quality testing
Testing of water samples for turbidity using a portable turbidimeter (SGZ-200BS, Shanghai Yuefeng Instruments Co., Ltd., China).. The pH of the water samples was measured using a benchtop pH meter (FE20, Mettler-Toledo Instruments (Shanghai) Co., Ltd., China). Chemical oxygen demand (CODcr) was determined with a total organic carbon analyser (vario TOC cube, elementar, Germany). In this case, the water sample is filtered through a 0.45µm microfiltration membrane to remove the effect of inorganic particles in the water on the measurement results before the CODcr test is carried out.
2.3.2 Testing for opportunistic pathogens
The q-PCR method was used to quantify the concentrations of three opportunistic pathogens (Legionella, Pseudomonas aeruginosa, Mycobacterium avium) and Escherichia coli in water. 1000 mL of the sample to be tested was taken, and the opportunistic pathogens in the water sample were enriched onto a 0.22 µm membrane using a vacuum filtration device. Finally, 80 µL of eluent was added to obtain approximately 75 µL of DNA, which was stored at -20°C. The samples were sent to Beijing Boyunhui Biotechnology Co., Ltd. for DNA extraction, amplification and quantification using a PCR instrument (CFX Manager biorad, USA). Primer sequences for the detection of different types of opportunistic pathogens by PCR are shown in Table 2.
|
Opportunistic pathogens |
Genes |
Probes and Primers |
|---|---|---|
|
Legionella |
23S rRNA |
F: CCCATGAAGCCCGTTGAA R:ACAATCAGCCAATTAGTACGAGTTAGC P:TCCACACCTCGCCTATCAACGTCGTAGT |
|
Pseudomonas aeruginosa |
oprl |
F:GACGTACACGCGAAAGACCT R:GCCCAGAGCCATGTTGTACT |
|
Mycobacterium avium |
16S rRNA |
F:AGAGTTTGATCCTGGCTCAG R:ACCAGAAGACATGCGTCTTG |
|
Escherichia coli |
yccT |
F:AGCGTTCGTCCTGCACAAGT R:TCCACCATGCTCAGGGAGAT |
2.4 Quantitative Microbial Risk Assessment (QMRA)
2.4.1 Hazard identification
Three types of opportunistic pathogens (Legionella, Pseudomonas aeruginosa, Mycobacterium avium) were selected for health risk evaluation by screening the QMRA wiki database for various types of pathogenic microorganisms and identifying opportunistic pathogens and their routes of infection. The total fatality rate of E. coli was less than 1% and was not a opportunistic pathogens. In this study, E. coli was not evaluated for risk as an indicator pathogen, but its correlation with each opportunistic pathogens and its changes were examined.
2.4.2 Exposure assessment
The study selected Beijing Olympic Forest Park as an exposure evaluation scenario for reclaimed water reuse. The landscape recreation activities in Beijing Olympic Forest Park included boating, children playing in the water, and viewing on the water deck, among which boating and children playing in the water may cause hand-eye contact with Pseudomonas aeruginosa and oral ingestion of Legionella and Mycobacterium avium after exposure to water. Viewing waterscape may cause oral ingestion of Legionella and Mycobacterium avium after aerosolization of water droplets.
The exposure dose d, d = C × v × t. Where C refers to the concentration of opportunistic pathogens in water, v refers to the volume of a single exposure of a body of water to humans, and t refers to the duration of a single exposure of a body of water. v, t, f and other QMRA exposure parameter values were selected based on existing literature references (Man-de et al., 2014; Cui, 2017; Sales-Ortells et al., 2015; Goswami et al., 2018; Oster et al., 2014; Stoddard et al., 2015).
2.4.3 Dose-response assessment
In this study, the best dose response models and parameters for three opportunistic pathogens, Legionella, Pseudomonas aeruginosa and Mycobacterium avium, were selected from the QMRA wiki database and based on existing studies, as shown in Table 3 (Porter et al., 2021; Rasheduzzaman et al., 2019; Breuninger et al., 2015; QMRA Databases) below.
Notes: N50 is the dose at which 50% of exposed subjects produce a response, d is the exposure dose, Pi is the single event probability of infection.
2.4.4 Risk characterization
The stochastic risk values generated by Monte-Carlo simulations were expressed using bar charts during the study. The USEPA recommended exposure infection limit of 0.0320 for landscape recreational waters (USEPA, 2012) was chosen as the reference value for the probability of infection for a single exposure in the risk evaluation of this study.
3.1 Analysis of the efficacy of different processes for the removal of opportunistic pathogens
Under the conditions of optimum PACl dosage (30mg/L), the above three opportunistic pathogens as well as E. coli content in the raw water and the effluent water before and after disinfection by two treatment processes, coagulation and sedimentation and coagulation and sedimentation-UF, were tested and the disinfection units were evaluated for their inactivation effect on the pathogenic microorganisms in the water, the results are shown in Fig. 1.
As can be seen from Fig. 1, the concentrations of Legionella, Pseudomonas aeruginosa, Mycobacterium avium and Escherichia coli in the simulated secondary effluent were (77664 ± 603), (2887 ± 86), (46194 ± 196) and (2104 ± 114) copies/mL respectively. The reduction in the levels of the three opportunistic pathogens and E. coli in the water after treatment with different processes was of different degrees. The removal rates of Legionella, Pseudomonas aeruginosa, Mycobacterium avium and Escherichia coli were 37.6%, 67.6%, 52.2% and 49.6%, respectively. After disinfection with NaClO, the removal rates of the above pathogenic microorganisms increased to 49.9%, 78.6%, 66.3% and 91.6%, respectively. Legionella, Pseudomonas aeruginosa, Mycobacterium avium and Escherichia coli in the effluent of the membrane were (3565 ± 147), (123 ± 26), (2867 ± 106) and (40 ± 5) copies/mL respectively, with removal rates of 95.4%, 95.1%, 98.1% and 98.1% respectively. After the membrane effluent is sterilized by NaClO, the removal rate of the above pathogenic microorganisms is further improved, with removal rates of 99.8%, 98.6%, 99.4% and 99.1% respectively. The above results show that the ultrafiltration unit can enhance the removal of opportunistic pathogens from water and that disinfection is an important treatment unit to ensure the effectiveness of microbial treatment in water.
Analysis of the reasons are as follows: the method of coagulation and sedimentation treatment on the raw water Legionella, Pseudomonas aeruginosa, Mycobacterium avium, Escherichia coli removal rate of 37.6% ~ 67.6%, there is a good removal effect. This is because the surface of these microorganisms are mostly composed of polysaccharides, proteins, the existence of colloidal nature in the water, coagulation and sedimentation although can be removed by removing suspended solids and colloids and other particles in water to remove the microorganisms (Uluseker et al., 2021), but the removal effect is still limited.
After the combination of coagulation sedimentation and NaClO disinfection, the removal rate of E. coli from the raw water increased to 91.6%, which was a significant improvement. With the addition of disinfection unit, the removal rates of the combined process for opportunistic pathogens (Legionella, Pseudomonas aeruginosa and Mycobacterium avium) in water were 49.9%, 78.6% and 66.3%, respectively, which were only 12.3%, 11.0% and 14.1% higher than those of coagulation precipitation, respectively. The removal effect did not improve significantly. This is because the hydrolysis of NaClO produces HClO, which invades into the cell interior through the cell wall of the bacterium, destroying the enzyme state and causing the death of E. coli due to metabolic disorders. In addition, HClO will further decompose to produce strong oxidizing neo-oxygen [O], which will oxidize with nucleic acid and protein, thus destroying DNA, the chlorine contained in NaClO and the protein of the bacterium. The chlorination that occurs also plays a role in the removal of E. coli (Stange et al., 2019). However, compared to E. coli, opportunistic pathogens such as Legionella, Pseudomonas aeruginosa and Mycobacterium avium are more resistant to chlorine, resulting in the disinfection effect of HClO produced by NaClO hydrolysis being less prominent. It has been shown (Kuchta et al., 1985) that the cell membrane of Legionella pneumophila contains high concentrations of phosphatidylcholine and that Legionella pneumophila maintains a hydrophobic cell surface, so this particular biological outer membrane component may contribute to its resistance to chlorine. Studies have shown (El-Helow et al., 2020) that the mucus containing fucoidan on the surface of Pseudomonas aeruginosa protects Pseudomonas aeruginosa against chlorine and may contribute to its survival in chlorinated water systems. The mycoplasma acid structure of Mycobacterium avium is a determinant of mycobacterial membrane fluidity, and Mycobacterium avium may alter membrane permeability to chlorine by changing the composition of lipids and fatty acids on the cell surface (Liu et al., 2019). The removal of E. coli and opportunistic pathogens was further enhanced by the addition of ultrafiltration units, because UF membranes can enhance the removal of pathogenic microorganisms from water through the sieving effect of their own pore size and the adsorption and retention of membrane pore sidewalls (Pu et al., 2020) .
3.2 Correlation analysis of opportunistic pathogens and Escherichia coli in water
During the experiment, in order to investigate the relationship between opportunistic pathogens and the indicator pathogen E. coli in water and to discuss their changes after different treatment processes. E. coli and three opportunistic pathogens (Legionella, Pseudomonas aeruginosa and Mycobacterium avium) in the simulated secondary effluent and in the effluent of both coagulation sedimentation-NaClO disinfection and coagulation sedimentation-UF-NaClO disinfection processes. The correlation analysis was performed and if P < 0.05, the correlation was determined to be significant.
3.2.1 Correlation analysis of opportunistic pathogens with Escherichia coli in simulated secondary effluent
During the test, the three opportunistic pathogens levels and E. coli levels in the secondary effluent were fitted and analysed. The results are shown in Fig. 2.
As can be seen from Fig. 2, the R2 of the fitted results of E. coli and Legionella, Pseudomonas aeruginosa and Mycobacterium avium in raw water were 0.727, 0.889 and 0.842 respectively, with P-values of 0.004, 0.006 and 0.009 (all less than 0.05), showing a significant positive correlation. This indicates that the content of Legionella, Pseudomonas aeruginosa and Mycobacterium avium in the secondary effluent will decrease with the reduction of E. coli. The E. coli index in the secondary effluent of the wastewater plant can reflect the content of Legionella, Pseudomonas aeruginosa and Mycobacterium avium to a certain extent and has a certain indicator function.
3.2.2 Correlation analysis of opportunistic pathogens and E. coli in different process effluents
During the test, the three opportunistic pathogens and E. coli levels in the effluent of the coagulation sedimentation-NaClO and coagulation sedimentation-UF-NaClO processes were fitted and analysed. The results are shown in Fig. 3 and Fig. 4 respectively.
As seen in Fig. 3 and Fig. 4, the R2 of Legionella, Pseudomonas aeruginosa, Mycobacterium avium and Escherichia coli in water after coagulation sedimentation-NaClO disinfection were 0.031, 0.045 and − 0.067 respectively, with P-values of 0.175, 0.213 and 0.260, all greater than 0.05, indicating that there was no significant correlation between the three opportunistic pathogens and E. coli in the effluent of the process. The R2 values for Legionella, Pseudomonas aeruginosa, Mycobacterium avium and Escherichia coli in the coagulation sedimentation-UF-NaClO disinfected water were − 0.186, -0.081 and 0.123 respectively, with P-values of 0.225, 0.316 and 0.351 respectively, all greater than 0.05 and not significantly correlated. This indicates that there is no significant correlation between E. coli and the opportunistic pathogens (Legionella, Pseudomonas aeruginosa, Mycobacterium avium) in the secondary effluent after treatment at different depths, and that the E. coli content is no longer a complete indicator of the three opportunistic pathogens mentioned above.
Therefore, further research is needed to determine whether E. coli can act as an indicator pathogen for the presence of opportunistic pathogens (Legionella, Pseudomonas aeruginosa, Mycobacterium avium) in the process of reclaimed water reuse.
3.3 Health risk assessment of opportunistic pathogens in different process effluents
3.3.1 Health risks of Legionella in different process effluents
The discussion simulates the probability distribution of the health risk posed by Legionella bacteria in the effluent of the three processes of direct NaClO disinfection, coagulation sedimentation-NaClO and coagulation sedimentation-UF-NaClO during three landscape recreational activities: boating in the lake, children playing in the water and viewing waterscape, respectively. As shown in Fig. 5, Fig. 6 and Fig. 7.
The results show that the single exposure probability of Legionella infection in secondary effluent disinfected by NaClO for direct reuse in landscape recreational activities was below 0.4400 ~ 1.0000. Under the anchor value of 0.0320 recommended by USEPA, the process safety guarantee rates of boating in the lake, children playing in the water and viewing watersacpe were 0.4%, 1.0%, and 1.3%, respectively. The single exposure probability of Legionella infection in the secondary effluent after disinfection by coagulation sedimentation-NaClO was 0.2400 ~ 0.7000, and the process safety guarantee rate for the three landscape recreational activities of boating, children playing in the water and viewing watersacpe were 8.1%, 8.7% and 17.9% respectively. While the secondary effluent was disinfected by coagulation sedimentation-NaClO. The single exposure probability of Legionella infection in landscape recreation activities after disinfection by coagulation sedimentation-UF-NaClO was below 0.0220 ~ 0.0930, and the process safety guarantee rate of the three landscape recreation activities of boating, children playing in the water and viewing watersacpe were 99.3%, 70.9% and 100% respectively.
3.3.2 Health risks of Pseudomonas aeruginosa in different process effluents
The health risk of Pseudomonas aeruginosa is mainly caused by hand-eye contact with water, which can occur during two leisure activities: boating and children playing in the water. The probability distribution of the health risk of Pseudomonas aeruginosa in the effluent of the three processes, direct NaClO disinfection, coagulation sedimentation-NaClO and coagulation sedimentation-UF-NaClO, during the two landscape leisure activities of boating and children playing in the water, are discussed and shown in Fig. 8, Fig. 9 and Fig. 10.
The results show that the single exposure probability of Pseudomonas aeruginosa infection in secondary effluent disinfected by NaClO for direct reuse in landscape recreational activities was below 0.4000. Under the anchor of the exposure infection limit of landscape recreational water recommended by USEPA of 0.0320, the process safety guarantee rates of secondary effluent NaClO disinfection for boating and children playing water were 12.6% and 13.6%, respectively. The single exposure probability of Pseudomonas aeruginosa infection in the secondary effluent disinfected by coagulation sedimentation-NaClO and reused in landscape recreational activities was below 0.2400, the safety assurance rate of the process for the two landscape recreational activities of boating and children playing in the water were 53.9% and 54.4% respectively. While the secondary effluent disinfected by coagulation sedimentation-UF-NaClO disinfection, the single exposure probability of Pseudomonas aeruginosa infection was around 0.0190, and the safety guarantee rate of the process for both boating and children playing in the water was 99.3%.
3.3.3 Health risks of Mycobacterium avium in different process effluents
The results of simulating the probability of health risk to humans from Mycobacterium avium in the effluent of three processes, direct NaClO disinfection of secondary effluent, coagulation sedimentation-NaClO and coagulation sedimentation-UF-NaClO, during three types of landscape recreational activities: boating in the lake, children playing in the water and viewing watersacpe. As shown in Fig. 11, Fig. 12 and Fig. 13.
The results showed that the probability of single exposure to Mycobacterium avium in secondary effluent disinfected by NaClO for direct reused in landscape recreational activities was mostly below 0.7500 ~ 1.0000. Subject to anchoring at the USEPA recommended exposure exposure limit of 0.0320 for landscape recreational water bodies, the safety guarantee rate of the process for the three types of landscape recreational activities were 1.5%, 1.8% and 2.7% respectively. The single exposure probability of infection of Mycobacterium avium in the secondary effluent after coagulation sedimentation-NaClO disinfection for landscape recreational activities was mostly below 0.2700 ~ 0.5800. The safety guarantee rate of boating in the lake, children playing in the water and viewing watersacpe were 22.2%, 16.8% and 17.2%, respectively. The single exposure probability of Mycobacterium avium infection in the secondary effluent after disinfection by coagulation sedimentation-UF-NaClO was below 0.0400 ~ 0.1000, and the safety guarantee rate of this process for the three landscape recreational activities of boating, children playing in the water and viewing watersacpe were 95.9%, 92.3% and 86.2% respectively.
(1) For the simulated secondary effluent, the removal rate of E. coli by the combined coagulation sedimentation-NaClO process was 91.6%. However, the process was not ideal for the removal of opportunistic pathogens, with 49.9%, 78.6% and 66.3% for Legionella, Pseudomonas aeruginosa and Mycobacterium avium respectively. The combined coagulation sedimentation-UF-NaClO process had a good effect on the removal of Legionella, Pseudomonas aeruginosa, Mycobacterium avium and Escherichia coli from water, removal rates of 99.8%, 98.6%, 99.4% and 99.1% respectively.
(2) There is a significant positive correlation between the concentration of E. coli and the concentration of the three opportunistic pathogens in the simulated secondary effluent, and the E. coli index in the secondary effluent can reflect the distribution of opportunistic pathogens in water to a certain extent. No significant correlation between E. coli concentrations in water and the three opportunistic pathogens after secondary effluent treatment by the two combined processes due to the chlorine resistance of the opportunistic pathogens.
(3) The secondary effluent was directly disinfected and reused in urban landscape and recreational activities, the single infection probability of the three opportunistic pathogens was the highest. The process had a process safety margin of 0.4–13.6% for different opportunistic pathogens under the anchoring premise of the USEPA recommended contact infection limit of 0.0320 for landscape recreational water. The secondary effluent was disinfected by coagulation sedimentation-UF-NaClO and then reused in urban landscape recreational activities, the single infection probability of the three opportunistic pathogens was the lowest, and the process safety guarantee rate can reach 70.9%~100%.
Funding information This study was supported by National Natural Science Foundation of China (No. 52070011).
- Ethics approval and consent to participate: Not applicable.
- Consent for publication: Not applicable.
- Availability of data and materials: All data generated or analysed during this study are included in this published article.
- Competing interests: The authors declare that they have no competing interests.
- Authors' contributions: All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Hao Tong, Lihua Sun and Muxi Zhang. The first draft of the manuscript was written by Zixuan Xi and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.
- Breuninger KJ, Weir MH (2015) Development of an interspecies nested dose-response model for Mycobacterium avium subspecies paratuberculosis. Risk Anal 35(8): 1479-1487
- Cui QJ (2017) Diversity and risk of human bacterial pathogens in the urban waters for landscape recreational. Dissertation, Tsinghua University
- Dou PQ, Sun CB (2018) Health risk assessment and the emergency treatment of the sewage reclaimed and reused for flotation. J Saf Environ 18(01):252-256
- El-Helow ER, Atalla RG, Sabra WA, et al (2020) Kinetic studies on the expression of alginate and extracellular proteins by Pseudomonas aeruginosa FRD1 and PAO1. J gen Appl Microbiol 66(1)
- Fu JR, Zhou AJ, Liu Y, et al (2021) Research progress of urban sewage reclamation technology in China. Industrial Water Treatment 41(01):18-24+37
- Goswami M, Khan FA, Ibrisevic A, et al (2018) Development of Escherichia coli based gene expression profiling of sewage sludge leachates. J Appl Microbiol 125(5)
- Kuchta JM, States SJ, McGlaughlin JE, et al (1985) Enhanced chlorine resistance of tap water-adapted Legionella pneumophila as compared with agar medium-passaged strains. Appl Environ Microb 50: 21-26
- Li XL (2021) Study on membrane fouling control and mechanism of EfOM ultrafiltration for secondary effluent of municipal wastewater treatment plant. Dissertation, Guangzhou University
- Liu LZ, Xing XC, Hu C, Wang HB (2019) One-year survey of opportunistic premise plumbing pathogens and free-living amoebae in the tap-water of one northern city of China. J Environ Sci 77(03):20-31
- Ma YL, Bai X, Hu MT, et al (2015) Research progress on health risk assessment of reclaimed water irrigation in greenbelt. Journal of Irrigation and Drainage 34(S1):178-182
- Man-de H, Berg-van-den HHJL, Leenen EJTM, et al (2014) Quantitative assessment of infection risk from exposure to waterborne pathogens in urban floodwater. Water Res 48(Jan.1): 90-99
- Md R, Rajveer S, Charles NH, et al (2019) Reverse QMRA as a Decision Support Tool: Setting Acceptable Concentration Limits for Pseudomonas aeruginosa and Naegleria fowleri. Water 11(9)
- Oster RJ, Wijesinghe RU, Haack SK, et al (2014) Bacterial pathogen gene abundance and relation to recreational water quality at seven Great Lakes beaches. Environ. Sci. Technol 48(24): 14148-14157
- Porter CK, Talaat KR, Isidean SD, et al ( 2021) The Controlled Human Infection Model for Enterotoxigenic Escherichia coli.. Curr. Top. Microbiol. Immunol. https://doi:10.1007/82_2021_242
- Pu JH, Liu Y, Zhang JC, et al (2020) Virus Disinfection from Environmental Water Sources Using Living Engineered Biofilm Materials. Adv Sci 7(14)
- Quantitative Microbial Risk Assessment wiki Databases: http://qmrawiki.canr.msu.edu
- Sales-Ortells H, Agostini G, Medema G (2015) Quantification of waterborne pathogens and associated health risks in urban water. Environ. Sci. Technol 49(11): 6943-6952
- Stange C, Sidhu J, Toze S, et al (2019) Comparative removal of antibiotic resistance genes during chlorination, ozonation, and UV treatment. Int J Hyg Envir Heal 222(3): 541-548
- Stoddard SF, Smith BJ, Hein R, et al (2015) RrnDB: improved tools for interpreting rRNA gene abundance in bacteria and archaea and a new foundation for future development. Nucleic Acids Res 43: 593-598
- Uluseker C, Kaster KM, Thorsen K, et al (2021) A review on occurrence and spread of antibiotic resistance in wastewaters and in wastewater treatment plants: mechanisms and perspectives. Front Microbiol. https://doi:10.3389/FMICB.2021.717809
- USEPA. Recreational Water Quality Criteria. 820-F-12-058. Ofice of Water: Washington, DC, 2012.
- Zhang CQ, Dong XW, Wang R, et al (2022) Health risk assessment of virus in reclaimed water with different reuse approaches. Environ. Sci. Technol 45(01):137-144