Subject Patient samples
A total of 30 NHL participants and 30 age and sex-matched healthy controls were recruited consecutively for this study from Fujian Cancer Hospital from Sep 2019 to Aug 2020. All study protocols were approved by the Ethics Committee of Fujian Cancer Hospital (No: SQ2020-061-01). Written informed consents were obtained from all participants.
Collection of PBMCs and total RNA extraction
Blood was collected in the presence of an anticoagulant (EDTA) form. The Ficoll Histopaque density gradient centrifugation method was used to isolate peripheral blood mononuclear cells (PBMCs) within 6 h of sample collection[22]. Samples were cryopreserved and stored at −80 °C. Total RNA extraction was isolated from PBMCs using Neurozol reagent (MACHEREY-NAGEL, Germany) according to the manufacturer's instructions[23]. The extracted RNA was dissolved in RNase-free water and the concentrations of RNA were determined at OD260 using a NanoDrop ND-1000 (Thermo Fisher Scientific, USA).
RT-qPCR
Total RNA was extracted using Neurozol reagent (MACHEREY-NAGEL, Germany) and cDNA was generated using a reverse transcription reagent kit (PROMEGA, USA). Real time PCR was performed using SYBR Green PCR kit (TaKara, China). β-actin was used as an internal control. The qPCR analysis was performed on an ABI 7500 Real-time PCR System (Applied Biosystems, Thermo Fisher Scientific, USA) according to the instructions supplied by the manufacturer. The relative expression levels of the genes were calculated by comparing β-actin using the 2−ΔΔCT method. The primers were used as the followings:
PD-L1-F(homo) AGGCCGAAGTCATCTGGACA
PD-L1-R(homo) TGTTGATTCTCAGTGTGCTGGT
HPK1-F(homo) CCAGGTAGAGGAAGATATGGTGAT
HPK1-R(homo) GATCTCAGGTGTGCGAAGTC
PD-1-F(homo) CGGAGTATGCCACCATTGTC
PD-1-R(homo) CCAAGAGCAGTGTCCATCCT
NLRP3-F CGTGAGTCCCATTAAGATGGAGT
NLRP3-R CCCGACAGTGGATATAGAACAGA
β-actin F TGACGTGGACATCCGCAAAG
β-actin R CTGGAAGGTGGACAGCGAGG
Cell culture
The cell lines (Karpas-299: human non-Hodgkin's Ki-positive large cell lymphoma; WSU-DLCL2: human diffuse large cell lymphoma; Ramos: human Burkitt's lymphoma; BJAB: human Burkitt lymphoma B; Human normal B lymphocyte cell line RPMI 1788) were purchased from the American Type Culture Collection (ATCC, USA) or National Infrastructure of Cell Line Resource (Beijing, China). Cells were incubated in RPMI 1640 (Gibco, USA) containing 10% fetal bovine serum (FBS; PAN biotech, Germany) and 1% penicillin/ streptomycin (Solarbio, China) at 37°C and 5% CO2.
Lentivirus production by shHPK1 and HPK1 overexpression
The shRNA targeted to HPK1 (Ref Seq ID: nm_001042600.3) was designed through Invitrogen RNAi designer website. The shRNA sequence was custom synthesized and inserted between BamHI and EcoRI sites of the lentivirus vector pLVZG-U6-ZsGreen1-Puro. Sequences (5'to 3') were as followings.
HPK1-shRNA1: GATCCGCCTTCCACAACTTCATCAAATTCAAGAGATTTGAT GAAGTTGTGGAAGGCTTTTTG. HPK1-shRNA2: GATCCGACTAAGAGTCCC
AAGAAATTCAAGAGATTTCTTGGGACTCTTAGTCTTTTTG. HPK1-shRNA3: GATCCCAAGATGCTCAGTCATCAATTCAAGAGATTGATGACTGAGCATCTTGTTTTTG. The full-length sequence of HPK1 (RefSeq ID: nm_001042600.3) was custom synthesized and inserted between XbaI and NotI site of lentivector pLVZG-CMV-copGFP-Puro. 293T cells were transfected via Lipofectamine 3000 (Life Technologies), with the plasmids pLVZG-shHPK1 with pMDLg/pRRE, pRSV-Rev and pMD2.G plasmid. Supernatants were collected 48 and 72 h post transfection and concentrated by Pierce™ PES Concentrator. Construction of a stable shRNA cell line was screened by puromycin treatment.
Co-immunoprecipitation
Cells were harvested in lysis buffer (50 mM Tris-HCl (pH 7.4), 100 mM NaCl, 2 mM EDTA, 1 mM DTT, 1% Triton X-100, and 0.1% SDS) supplemented with protease inhibitors. IPs were performed through incubation of 2 μg antibodies with lysates (2 mg protein) at 4 °C for 2 h, followed by incubating with protein A/G beads (Sigma, USA) at 4 °C for 2 h[24]. The washed samples were analyzed by Western blotting.
Primary PBMC culture and co-culture with NHL cells
PBMCs were isolated from peripheral blood of healthy donors using Ficoll Hypaque gradient centrifugation as above method and were cultured in 24-well plates using supplemented RPMI-1640 medium, and incubated at 37°C in a humidified, 5% CO2 atmosphere. The co-culture experiment was carried out when the subcultured PBMCs in 6-well plates grew to 70-80%. For co-culture, BJAB and WSU-DLCL2 cells were separately co-cultured with PBMCs at a ratio of 1:4 for at least 72 h. Anti-CD3 (BioLegend, San Diego, CA, USA; Cat. no. 317325) antibody, anti-CD28 (BioLegend, Cat. no. 302933) antibody, and recombinant human IL-2 (20 U/mL, R&D Systems, Minneapolis, MN, USA) were added to the cocultures to maintain activation and expansion of T cells. On days 3, 7, and 10, cells were harvested, stained with antibodies, and then analyzed using flow cytometry. The cells also were stained with 0.4% trypan blue. The diameter of PBMCs was 10 μm. The diameter and size of BJAB and WSU-DLCL2 cells were around 14.5 μm. Therefore, the cell diameter was greater than 12.5 μM representing the NHL cells. The number of NHL cells stained with Trypan blue was counted by a cell counter with a hemacytometer.
CCK-8 assay
BJAB and WSU-DLCL2 cells were plated at 2×103 cells/well in 96-well plates and grown in medium containing 10% FBS for 24 h. 10 μl of CCK-8 (cell count kit-8, Dojindo, Japan) was added into each well and cells were incubated for 2 h in a 5% CO2 incubator at 37°C. The absorbance of each well at 450 nm was read in GloMax™ 96 MICROPLATE (Promega, USA).
Soft-agar Colony formation assay
800 cells were mixed with 0.4% agarose in growth medium, plated on top of a solidified layer of 0.5% agarose in growth medium in 6-well plates, and fed every 3 d with growth medium. After 3–4 weeks, the colonies were dyed with Crystal Violet (0.01% solution). Images were photographed and the number of colonies was calculated by Image J software.
FACS Analysis
For apoptosis, Cultured cells were trypsinated and around 1 × 106 cells were stained with Annexin V-FITC (0.5 μg/ml) for 10 min and processed for flow cytometry using a FACS cytometer (FACSVerse, BD Biosciences) without delay. For co-cultured PBMCs, cells were trypsinated and around 1 × 106 cells were stained with APC anti-human CD3 (Proteintech, Cat: APC-65151), and PE anti-CD8A (Proteintech, Cat: PE-65144CD8a) antibody (0.5 μg/ml) for 30 min and processed for flow cytometry.
Western blotting
Cells were collected and lysed with RIPA buffer (Beyotime, China). Equal amount of protein was separated on SDS-PAGE and transferred to PVDF (Millipore, USA). Then, the membranes were incubated with the primary antibodies as the followings: All antibodies were purchased from Proteintech, China. anti-BAX (50599-2-Ig); anti-NF-ΚB P65 (66535-1-Ig); anti-HPK1 (23950-1-AP); NLRP3 (19771-1-AP); anti-p53 (60283-2-Ig); anti-PD-1/CD279 (18106-1-AP); anti-PD-L1/CD274 (66248-1-Ig) and β-actin (66009-1-Ig). ECL substrates were used to visualize protein bands (Millipore, USA).
Zebrafish xenograft models
WSU-DLCL2 and BJAB were stained with 4 μg/ml Dio (green, Thermo) and PBMCs was stained with 4 μg/ml DiL (red, Thermo) for 2 h at 37C in E3 medium. Cells were then washed, trypinated, and resupended in RPMI 1640 for microinjection. The zebrafish embryos with 48 hpf were anesthetized with 0.02% tricaine (MS-222; Sigma-Aldrich). A total of 200-300 cells were injected into the hindbrain ventricle. All embryos were separately seeded in a 48-well plate at 28oC for 12 h and took photos by fluorescent microscopy. 1 μM anti-PD-1 antibody ( Camrelizumab,AiRuiKa™, Hengrui Medicine Co. Ltd, China) as a PD-1 inhibitor and HPK1 inhibitor GNE-1858 (20 μg/ml) were added to the well plate and incubated at 28oC for 96 h. at least 15 zebrafishes were eamined in each group. The fluorescent intensityensity of implanted cells was monitored every 12 h by microscopy and analyzed by Image J software. (n=12).
Statistical analysis
All experiments were replicated thrice and all data were expressed as mean + standard deviation (SD). The software GraphPad 6.0 was used to carry out all statistical analyzes. Student's t-test and one-way ANOVA followed by Bonferroni's post hoc test were utilized to analyze 2 or multiple groups, respectively. * means p < 0.05; ** means p < 0.01; *** means p < 0.001.