1. Experimental animals
As described previously [20], Sidt2 KO mice were constructed using Cre-LoxP gene targeting technology and performed by Shanghai Southern Model Company. All animal experiments were approved by the Animal Ethics Committee of Wannan Medical College.
2. Cells
INS-1 cells (RRID: CVCL_0352) were purchased from Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences. The cells were cultured in RPMI-1640 supplemented with 10% fetal bovine serum (FBS) (Gibco ®, Invitrogen, Shanghai, China) and incubated at 37°C in 5% CO2. All studies were conducted between 5 and 20 generations of INS-1 cells.
3. Whole blood DNA extraction and SNP identification
5 ml venous blood was extracted from fasting people and stored at -80°C after sufficient anticoagulation. Whole blood genomic extraction kit (DP304, TIANGEN) was used to extract blood DNA according to the instructions. After PCR with the following three pairs of primers for the Sidt2 promoter, the length of the SNP A1521G, G1816A and C502A were 809bp, 791bp and 324bp, which were directly sequenced on the automatic sequencer of Applied Biosystems (3730, BGI, Shanghai).
Table 1
Three pairs of primers were designed according to the Sidt2 promoter region.
Primer 809 | 5′-ATTTCCTTAGGATAGAGTCCAG-3′ 5′-AGAGTGAGGGGCGTGATA-3′ |
Primer 791 | 5′-AACCACTCACAATCCATT-3′ 5′-TTTATACCCTTTGATCCAG-3′ |
Primer 324 | 5′-TAAGGGCAAATGCGGGACC-3′ 5′-TGAGAAGGAGGGCGGCTG-3′ |
4. Glucose tolerance test
After 12 hours of fasting, mice were given 2g/kg of d-glucose solution by intraperitoneal injection. Blood was collected from the tail tips and blood glucose was detected at 0, 15, 30, 60, 90 and 120min by a glucose meter (Sinocare CA-3, China).
5. Insulin tolerance test
After 6 hours of fasting, mice were given 0.75 U/kg insulin solution by intraperitoneal injection. Blood was collected from the tail tips and blood glucose was detected 0, 15, 30, 45, 60, 90, 120 min by a glucose meter (Sinocare CA-3, China).
6. Isolation and purification of islets
Mice were sacrificed by cervical dislocation. A 32 G needle was inserted into the duodenal papilla. The common bile duct was retrogradely injected with 1 mg/mL collagenase V solution (C9263, Sigma) until the pancreas was filled. The removed pancreas were digested at 37℃ for 28 min and vortexed for 10 s. A 15 ml of cold HBSS was added to stop digestion, and it was centrifuged 1000 rpm for 2 min at 4°C, supernatant was discarded and repeated washing. Islets were isolated by Histopaque-1077(10771, Sigma) and selected manually under microscope. 1ul RIPA was added to each islet to extract Islet proteins. About 100–120 islets could be purified from one mouse.
7.Glucose-stimulated insulin secretion (GSIS) experiments
The purified islets were incubated overnight in RPMI 1640 medium with 10% FBS to restore islet function.12-well plates were prepared, and each well was put 20 islets, the size and number of islets in each well were almost consistent. 750ul KRB Buffer was added to each well and incubated at 37℃ for 1 hour. The islets were transferred to a new 12-well plate with KRB buffer + 2.8mM glucose and incubated at 37℃ for 1 hour. 100ul supernatant was absorbed into the EP tube, which was the basal insulin secretion level. The islets were transferred to a new 12-well plate with KRB buffer + 16.7mM glucose and incubated at 37℃ for 1 hour. 100ul supernatant was collected into the EP tube, which contains the level of insulin stimulated by glucose. The supernatant was centrifuged and stored at -80℃. Insulin Elisa kits (EZRMI, Millipore) were used to detect insulin content in supernatant.
8.Immunofluorescence (IF)
Cells: The cells were planted uniformly on confocal dishes and fixed in 4% paraformaldehyde for 10 min when the density was appropriate. The cells were washed with PBS for 3 times and permeated in blocking solution (PBS solution containing 5% BSA and 0.3% Triton X-100) at room temperature for 1h. The cells were incubated with primary antibody at 4℃ overnight, washed with PBS for 3 times, incubated with secondary antibody at room temperature for 1.5 h, stained with DAPI for 10min, washed with PBS for 3 times and photographed.
Tissue: 3–5 mice were taken from each group, and pancreatic specimens were collected after perfusion, made frozen section (5µm), and fixed with 4% paraformaldehyde. After sealing, the tissue sections were incubated with primary antibody at 4℃ overnight. The fluorescent secondary antibody was incubated at room temperature for 1.5 h and washed with PBS. DAPI was stained, and the slices were photographed after washing with PBS.
Immunofluorescence double staining: Primary antibodies of different species (Mouse/Rabbit) were incubated simultaneously, and green/red fluorescent probes (Alex Fluor 488/594) were incubated simultaneously for secondary antibodies of different primary antibodies (Goat anti-mouse /Rabbit). The next steps are the same as IF. Antibodies see Table S3.
All images were taken under Leica and Olympus microscopes. No less than 3 mice were used in each group, and no less than 6 pancreatic slices were used in each mouse. The number of islets was no less than 30, and the total number of islet cells was > 1000. Average fluorescence intensity and fluorescence puncta was calculated by Image J. In order to count the proportion of positive cells, Image J was used to count the total number of INS + cells in the picture, and then the number of Glucagon+/Ngn3 + and other transcription factor positive cells in the islets were counted, and the proportion of positive cells was compared between the two.
9.Sidt2 gene was knocked out by CRISPR/Cas9
The lentiCRISPR-V2 plasmids (RRID: Addgene_52961) were selected as the carrier, and the sgRNA sequences (F: 5 '- CAGGTGCCCCTAATCCTGCG − 3', R: 5 '- CGCAGGATTAGGGGCACCTG − 3') were designed using sgRNA online web site (http://chopchop.cbu.uib.no/). The plasmids were linearized by BsmBI enzyme (E1602, NEB), and the sgRNA sequences were inserted by T4 ligase (M0202, NEB) to construct lenticRISPR-V2-SIDT2-sgRNA plasmids. 293T cells were transfected with LenticRISPR-V2 and LenticRISPR-v2-SIDT2-sgRNA plasmids using second-generation lentivirus packaging system collect high titer viruses. The collected lentivirus was transfected into INS-1 cells and puromycin was used to screen resistant cells. T7E1 enzyme (E3321, NEB) was used to confirm the presence of mutated bases. Monoclonal cells were further selected to construct stable Sidt2+/+ and Sidt2−/− INS-1 monoclonal cell lines. The primers (F:5’-TCCAAGGGCGAGCTTCTTCA-3’ and R:5’-GGGCTATACAGTGCCTCCTAT-3’) were used for DNA sequencing. The sequencing was completed by The Beijing Genomics Institute (BGI).
10.cloning of Sidt2.
The cDNA of Sidt2 was cloned into HBAD-Adeasy-mCherry vector allowing simultaneous expression of Sidt2 and mCherry. The Adeasy adenovirus packaging system was used, the MOI of INS-1 cells infected by the virus was 300, and the virus titer was > 1010 PFU/mL. After qPCR and WB were used to detect the Sidt2 expression, the model was constructed successfully. INS-1 cells with overexpression of Sidt2 were incubated in 50nM Lysotracker Green (40738ES50, Yeasen) working solution at 37℃ for 1h, the staining solution was removed, and fresh culture solution was added, and the staining situation was observed under Leica microscope.
11.RNA extraction and qPCR
RNA was extracted by Trizol method and reverse transcribed (K1691, Thermo Fisher Scientific)[42]. Primer sequence see Table S1-2.
12.Western blotting
The methods are described above[17]. Each WB experiment was repeated independently for no less than 3 times. β-Actin strips were used as internal parameters to normalize gray values, and Image J software was used for gray value statistics. Antibodies see Table S3.
13. Octreotide/glimepiride inhibits/promotes insulin secretion
INS-1 cells were cultured with 0-100mg/L Octreotide acetate (Hy-17365, MCE) in 1640 culture medium for 0–48 h. The supernatant was collected and the insulin content in the supernatant was detected by insulin Elisa kit (E-EL-R2466C, Elabscience) to determine the optimal concentration and time for octreotide to inhibit insulin secretion. INS-1 cells were balanced with sugar-free KRBH solution for 1 h, and then cultured with 16 mM glucose KRBH solution containing 0-200 µM glimperide (HY-B0104, MCE) for 1 h. The content of insulin in the supernatant was detected by insulin Elisa kit to determine the optimal concentration of glimperide to stimulate insulin secretion.
14. Immunohistochemistry
3–5 mice were taken from each group, the pancreases were fixed with 4% paraformaldehyde and made into paraffin-embedded slices (5µm). Paraffin sections were dewaxed and stained after antigen repair. Images were taken under Olympus microscope, and the average optical density was calculated by Image J software.
15. Transmission electron microscopy
Three 12-week-old WT and Sidt2 KO male mice were randomly selected to prepare electron microscopy specimens of pancreatic tissue, using the same method as before []. After locating the islet under the light microscope, the pancreas section of each mouse was conducted, one of six consecutive sections was selected, and no less than 10 slices were taken from each mouse. After random photography, 2–3 images with 20,000 times magnification were selected from the electron microscope pictures of each mouse, and the ultrastructural changes of the two groups were observed. The ratio of the number of empty granules to the total number of insulin secretion granules was calculated.
16. Mass spectrometric analysis of plasma
5 mL blood from 3 healthy people were extracted into anticoagulant tubes and centrifuged at 3000 rpm for 10 min to separate the upper plasma. The plasma samples were sent to BiotechPack company (Beijing, China) for protein identification, and the secondary peptide sequence map and protein content prediction were obtained. This scheme was approved by Medical Ethics Committee of Yijishan Hospital.
17. FITC/PI double staining
Apoptosis was detected by FITC/PI kit (556547, BD). The cells were digested with 0.25% trypsin, resuspended with cold PBS, and centrifuged at 1000 rpm for 5 min to collect the cells. The cells were resuspended twice with cold PBS and centrifuged at 1000 rpm for 5 min. 1 × 106/mL cells were taken as an example, resuspension with 1 × Binding Buffer. Take 100 µL suspension ( 1 × 105 cells ) into EP tube. 5 µL FITC and 5 µL PI were added, gently Vortexed, and incubated dark for 15 min. Add 400 µL 1×Binding Buffer solution to each tube for 1 h flow cytometry.
18. Cell viability detection
Cell Counting Kit-8 (CCK-8) (BS350A, Biosharp) was used to detect cell activity. Cells were seeded in 96-well plates and cultured for 0-48h. At different time points, 10 µL CCK8 solution was added to each well, and the reaction was continued for 1 h. The absorbance at 450 nm was measured by enzyme-labeled instrument, and the OD value at 0 h was normalized. CCK8 curves at different time points were plotted to reflect cells activities.
19. Separation of nuclear and cytoplasmic proteins
Cells were collected and re-suspended with 100 uL Buffer A (P0028, Beyotime), incubated on ice for 15 min, 12000 rpm at 4℃ centrifuged for 1min, and the deposits were washed with 1mL Buffer A for 3 times, re-suspended with 150uL Buffer B, 12000 rpm at 4℃ centrifuged for 30 min, and removed the supernatant (cytoplasmic proteins). The protein concentration was detected by the BCA method (P0009, Beyotime). The following steps were the same as WB.
20. Statistical analysis
The statistical analysis results were expressed as means ± SEM. Differences between the two groups were performed by unpaired T test. Statistical analysis was conducted with Graphics 9.0 software, and P < 0.05 was considered statistically significant.