Cloning and plasmid construction
The primer pair used for Hot Fusion was designed using CE Design V1.04. Each primer comprises a fragment of HSPA5 sequence and a 17–30 bp sequence of the pIRES-hrGFP-1a vector.
F-primer: ATGAAGCTCTCCCTGGTGGC
R-primer: CAACTCATCTTTTTCTGCTGTATCCT
The pIRES-hrGFP-1a vector was digested by EcoRI and XhoI (NEB) at 37°C for 2~3 h. Then enzyme-digested vector was run on a 1.0% agarose gel and purified using the Qiagen column kit. Total RNA was isolated from HeLa cells (CCTCC@GDC0009) with Trizol. Purified RNA was reverse transcribed into cDNA by oligo-dT priming. The cDNA was used as the template for PCR amplification. The linearized vector and PCR-derived insert were ligated using the ClonExpress® II One Step Cloning Kit (Vazyme). Plasmids were introduced into Escherichia coli by chemical transformation. Cells were plated onto LB agar plates containing 1μL/ml ampicillin, and incubated overnight at 37°C. Colonies were screened by colony PCR with universal primers that prime onto the vector backbone. Sanger sequencing was performed to verify the insert sequence.
The human HSPA5 gene was cloned by reverse transcription from total RNAs extracted from multiple cancer and non-cancer cell lines, followed by PCR amplification. The DNA fragment corresponding to a complete cDNA length was purified from a gel (MinElute PCR Purification Kit, Qiagen, 28004), and then cloned into the pIRES-hrGFP-1a vector (240031, Agilent Technologies) using the hot fusion method were designed with CE Design V1.04 (Vazyme Biotech Co., Ltd). Each of the primer comprises a fragment of gene specific sequence and a 17–30 bp sequence of the pIRES-hrGFP-1a vector. Please be noted that this vector also harbored a FLAG tag, which was fused to the 3’ end of APEX1. The primers used for cDNA cloning were as follow,
HSPA5 F Primer: agcccgggcggatccgaattcATGAAGCTCTCCCTGGTGGC
HSPA5 R Primer: gtcatccttgtagtcctcgagCAACTCATCTTTTTCTGCTGTATCCT
The pIRES-hrGFP-1a vector was digested by EcoRI (NEB, 3101S) and XhoI (NEB R0146V) at 37℃ for 2h~3h. Then enzyme-digested vector was run on 1.0% agarose gel and purified by Qiagen column kit (MinElute PCR Purification Kit, Qiagen, 28004). Then the insert fragment was synthesized by PCR amplification and PCR insert were added to a PCR microtube for ligation (T4 DNA ligase, NEB, M0202V) with ClonExpress® II One Step Cloning Kit (Vazyme, C112). Plasmids were introduced into Escherichia coli strain (DH5α) by chemical transformation. Cells were plated onto LB agar plates containing 30µg/ml ampicillin (sigma, 7177-48-2), and incubated overnight at 37℃. Colonies were screened by colony PCR (28 cycles) with universal primers (located on the backbone vector). The insert sequence was verified by Sanger sequencing.
Cell culture and transfections
The human cervical carcinoma (CC) cell line HeLa (CCTCC@GDC0009) was obtained from China Center for Type Culture Collection, Wuhan, Hubei, China. HeLa cells were cultured at 37°C with 5% CO2 in Dulbecco’s Modified Eagle’s Medium (DMEM) with 10% fetal bovine serum (FBS), 100 μg/mL streptomycin and 100 U/mL penicillin. The recombinant plasmid transfection of HeLa cells was performed using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol. Transfected cells were harvested after 48 h for real-time quantitative PCR (RT-qPCR) analysis and western blot.
Assessment of gene expression
Total RNA from HeLa cells was converted into cDNA as noted above and RT-qPCR was performed on the Bio-Rad S1000 with Bestar SYBR Green RT-PCR Master Mix (DBI Bioscience, Shanghai, China). The list of genes assessed and their corresponding primers is presented in Additional file 1. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene expression served as the control for assessing the effects of HSPA5 overexpression. The concentration of each transcript was then normalized to GAPDH mRNA level using the 2-ΔΔCT method [8]. GraphPad Prism software (San Diego, CA) was applied for the comparison with the paired Student's t-test.
Immunoprecipitation
HeLa cells were first lysed in ice-cold lysis buffer (1×PBS, 0.5% sodium deoxycholate, 0.1% SDS, 0.5% NP40) with RNase inhibitor (TAKARA, 2313U) and a protease inhibitor (Solarbio, Cat. No. 329986) on ice for 5 min. The mixture was then vortexed vigorously and centrifuged at 13,000 x g at 4°C for 20 min to remove cell debris. The supernatant was incubated overnight with DynaBeads protein A/G (Thermo, Cat. No. 26162) conjugated with anti-flag antibody (Sigma, F1804) or control IgG-antibody (CST, 2797s). Low-salt wash buffer, high-salt wash buffer and 1X Polynucleotide Kinase Buffer were used to wash the beads with the respective antibodies. The beads were resuspended in Elution Buffer (50 mM Tris-Cl (PH=8.0), 10 mM EDTA (PH=8.0), 1%SDS at 70 °C for 20 min and divided into two groups, one for RNA isolation from HSPA5-RNA complexes and another for the HSPA5western blot.
Western blot
The sample together with 1X SDS sample buffer was placed in boiling water for 10 minutes to elute the complex. The sample was then separated on 10% SDS-PAGE and transferred onto a membrane (Millipore, ISEQ00010). The membrane was blocked in TBST buffer (20 mM Tris-buffered saline and 0.1% Tween-20) containing 5% non-fat milk power for 1 h at room temperature after which the membrane was incubated with the primary antibody, anti-Flag antibody (1:2,000, Sigma, F7425) or anti-actin antibody (1:2000, CUSABIO) and then with HRP-conjugated secondary antibody (anti-mouse or anti-rabbit 1:10,000) (Abcam). Bound secondary antibody was detected using the enhanced chemiluminescence (advansta, K-12045-D10) reagent.
RIP-seq library preparation and sequencing
The HSPA5-bound RNAs were isolated from the immunoprecipitation of anti-Flag-HeLa lysate using TRIzol (Invitrogen). Complementary DNA (cDNA) libraries were prepared with the KAPA RNA Hyper Prep Kit (KAPA, Cat. No. KK8541) according the manufacturer’s procedure. The IP and input group, Each group had 2 replicate wells, in total Four RNA-seq samples were used second generation sequencing platform (RNA-Seq) to obtain HSPA5 Binding target. each experiment Was repeated 3 times, the libraries were prepared following the manufacturer's instructions and applied to Illumina Xten platform.
Data Analysis
Reads were aligned onto the human GENCODE Release 23 (GRCh38.p3) genome with TopHat 2 and only uniquely mapped reads were used for the following analysis. The “ABLIRC” strategy, a workflow for peak calling and analyzing CLIP-seq sequencing datasets(https://ablifedev.github.io/ABLIRC/) was used to identify the genome-level binding sites for HSPA5. Reads with at least 1 bp overlap were clustered as peaks. For each gene, computational simulation was used to randomly generate reads with the same lengths and number as reads in the peaks. The output reads were then further mapped to the same genes to generate random max peak height from overlapping reads. The entire process was repeated 500 times. All the observed peaks with heights greater than those of random maximum peaks (p < 0.05) were selected. The IP and input samples were independently analyzed via the simulation and the IP peaks that overlapped with Input peaks were removed. The IP target genes determined by the peaks and the binding motifs of IP protein were called by the HOMER software.
Functional enrichment analysis
To sort out functional categories of peak associated genes (target genes), Gene Ontology (GO) terms and KEGG pathways were identified using the KOBAS 2.0 server (http://kobas.cbi.pku.edu.cn/). Hypergeometric test and Benjamini-Hochberg False Discovery Rate controlling procedures were used to define the enrichment of each term.
Availability of data and materials
The data in this publication are available under the GEO Series accession number GSE169538.