The present study was performed conforming to the National Institutes of Health (NIH Publication, 8th Edition, 2011) guidelines in the use of laboratory animals. The animal care and experimental protocols were approved by the Xuzhou Medical University Committee on Animal Care.
Preparations of Lentivirus (LVs) and Plasmids
Recombinant lentivirus (PEDF-LV; Shanghai GeneChem Co,.Ltd, Shanghai, China) was prepared as previously described[26]. eNOS overexpression plasmids was successfully constructed and then packaged in 293T cells. The concentrated titer of virus suspension was 2 ×1012 TU/L.
Animal Feeding and Treatment
Sprague-Dawley male rats (weighing 250 ± 10 g, at 8–10 weeks of age, n=30) were obtained from the Experimental Animal Center of Xuzhou Medical College. Rats were housed in a temperature-controlled environment (22°C) with a 12-hour light/dark cycle. Rats had free access to food and water.
The γ-secretase inhibitor N-[N-(3,5-difluorophenacetyl)-L-alanyl]-S-phenylglycine t-butyl ester (DAPT) was obtained from MedChem Express (MCE, USA).All rats were randomly divided into 5 groups: the control group, vector group, PEDF-LV group, PEDF-LV + DMSO group, and PEDF-LV + DAPT group. The rats of the control group were only ligated with left anterior descending coronary artery (LAD). Lentivirus vector in 20 μl enhanced infection solution was delivered with a 20-μl syringe and 25-gauge needle into the myocardium along the LAD coronary artery in rats of the vector group. PEDF-LV (2 ×107 TU) in 20 μl enhanced infection solution was delivered into the myocardium along the LAD coronary artery in rats of the PEDF-LV group, PEDF-LV + DMSO group, and PEDF-LV + DAPT group. After 3 days, the rats of the PEDF-LV + DMSO group and PEDF-LV + DAPT group were injected intraperitoneally with DMSO or DAPT (100 mg/kg body weight) every 2 days (total of 5 injections).
Rat AMI Model
The AMI model was established surgically by ligation of the left anterior descending (LAD) coronary artery in anesthetized rats as [27]. Briefly, SD rats were anesthetized by intraperitoneal injection of 60 mg/kg sodium pentobarbital maintained under anesthesia using isoflurane (1.5–2.0%) mixed with air. Rats were placed on the operating table in a supine position and performed left thoracotomy through the fourth intercostal space under sterile condition. Then intramyocardial gene delivery was performed through myocardium injection directly. After reinstallation of spontaneous respiration, animals were extubated and allowed to recover from anesthesia, and postoperative analgesia was performed with buprenorphine administration at 0.5 mg/kg. Rats had the standard diet after surgery. 7 days later, we exposed the heart of rats and then occluded LAD using 6-0 silk suture (Ethicon, Johnson & Johnson, New Brunswick, USA) to generate the AMI with the same surgery. 5 minutes after ligation, the rat hearts were removed under anesthesia.
Lectin-FITC perfusion experiment
Lectin from Bandeiraea simplicifolia/ FITC (catalog No. L2895; Sigma-Aldrich, St. Louis, MO) non-specifically binds glycoproteins on the surface of endothelial cells and marks them in real time. We ligated the LAD of rats and injected one milliliter of Lectin-FITC (50 ug/ml) into their femoral veins. Lectin-FITC following the bloodstream to reach various grades of blood vessels marked CCMR vessels in the infarct area. After 5min of ligation, the hearts were harvested immediately to make frozen sections.
Vascular density measurement
Frozen sections from rat hearts that had been injected by lectin-FITC were fixed in 4% paraformaldehyde for 15 minutes, washed three times with PBS, and finally covered with 50% glycerol. Panoramas were acquired by scanning these samples using the Slide Scanning System (Olympus VS120). Ten randomly fields of view (15X) in the infarct area of each sample were selected to measure vessel density. Computer-based quantification of pictures was done with ImagePro Plus software (Media Cybernetics, Rockville, MD).
Preparations of PEDF Protein
Recombinant rat PEDF (GenBankTM Accession Number NM_177927) was synthesized by Cusabio Biotech, Co., Ltd. (Wuhan, China) as previously described [].
Cardiac Explant Angiogenesis Model
In order to explore the relationship between PEDF induced vascular remodeling and the Notch1 signaling pathway in vitro, we established the cardiac explant angiogenesis model as previously described[6, 28]. Put simply, we cut and rinsed the cardiac explants (1-2mm3) from neonatal Sprague-Dawley rats (1–3 days old, weighing 6.00.5 g). The cardiac explants were seeded on 24-well tissue culture plates (Corning, USA) coated with 250 μl Matrigel Basement Membrane Matrix and cultured in ECM at 37°C. Since PEDF has a strong inhibitory effect on angiogenesis, we added PEDF or DAPT on day 3 following implantation and observed on day 6. The models were randomly divided into four groups as follows: i) Control group; ii) PEDF group, PEDF protein (10 nmol/ml) was added to ECM on day 3; iii) PEDF +DMSO group, PEDF protein (10 nmol/ml) and DMSO (1:1000) were added to ECM on day 3; iv) PEDF+DAPT group, PEDF protein (10 nmol/ml) and DAPT (50μM,) were added to ECM on day 3.(Figure 2A)
Cell Culture
Human coronary artery endothelial cells (HCAECs, ScienCell, catalog #6020) were maintained in ECM growth media (ECM, ScienCell, catalog#1001) and used at passages 3-6. Cells were maintained at 37 °C in 5% CO2 in a humidified incubator. The cell cultures were fed every second day. HCAECs were subcultured or subjected to experimental procedures at 80% to 90% confluence.
Detection of γ-Secretase Activity
The assay was carried out in a microplate reader (Synergy2, BioTek, USA) using a γ-secretase Activity kit according to the manufacturer’s instructions. The γ-secretase activity kit (GMS50607.1 v.A) was obtained from GENMED SCIENTIFICS INC. USA. The peptide substrate double-labeled by fluorescent probe NMA donor and DNP acceptor were cleavaged by the γ-secretase, and released NMA with strong fluorescent signal. The principle of the assay is that the cell lysate is tested for secretase activity by detecting of the fluorescent signal intensity. The level of secretase enzymatic activity in the cell lysate is proportional to the fluorometric reaction.
Evaluation of NO production in fixed cells
Production of NO in HCAECs was assessed using NO indicator 3-Amino, 4-aminomethyl-2′, 7′-difluorescein, diacetate (DAF-FM DA) assay kit purchased from Beyotime (Jiangsu, China). DAF-FM DA can pass through the cell membrane and be catalyzed by the intracellular ester enzyme to release DAF-FM, which reacted with NO to produce strong fluorescent signal at an emission wavelength of 515 nm and an excitation wavelength of 495 nm. The cells were detached from the culture dishes by trypsin treatment, followed by being loaded with DAF-FM DA (5 M) in PBS (pH 7.4) for 20 min at 37 ◦C. Thereafter, cells were washed thrice and resuspended in PBS. Fluorescence was detected with a microplate reader (Synergy2, BioTek, USA). The fluorometric reaction index the NO level.
Immunofluorescence
Sections, cells or explants were fixed, respectively, with 4% paraformaldehyde for 15 minutes, permeabilized with 0.1% Triton X-100, and blocked with solution containing 5% bovine serum.
Specimens were incubated with anti-CD31(catalog no. ab24590; 1:200; Abcam, Cambridge, MA) and anti-VE-cadherin (catalog no. ab33168;1:300; Abcam) together for12 hours in 4°C. Next, secondary antibodies (catalog no. A21207; 1:200; Life Technologies, Carlsbad, CA) and Alexa Fluor 488 goat antimouse immunoglobulin G (catalog no.A11001; Life Technologies) were applied subsequently under light-protected conditions for 1 hour at room temperature. Nuclei were counterstained with 4,6-diamidino-2-phenylindole (DAPI; KeyGen Biotech, catalog #KGA215–10, China). Specimens were rinsed three times over 15min with PBS between each treatment. Finally, the specimens were observed under a fluorescence microscope (Olympus) or confocal laser scanning microscope (Olympus).
Western Blotting
Myocardial tissue protein from the infarcted area in rats and the cell protein from HCAECs were extracted with lysis buffer (pH 7.5) containing protease and phosphatase inhibitors (Sangon Biotech, catalog#C510003). In the same way, the endothelial cell protein of cardiac explants Angiogenesis was also extracted. The only difference was that we need to pick the endothelial cells under the microscope before the above procedures.
Primary antibodies for VE-cadherin, CD31, Dll4 (G-12, 1:1000, Santa Cruz Biotechnology), Notch1 (A7636, 1:1000, ABclonal), Cleaved Notch1 (Val1744) (4147S, 1:1000, Cell Signaling Technology), eNOS (32027S, 1:1000, Cell Signaling Technology ), phospho-endothelial nitric oxide synthase (P-eNOS) (9571S, 1:1000, Cell Signaling Technology), Akt (#3272S, 1:1000, Cell Signaling Technology), P-Akt (#9271S, 1:1000, Cell Signaling Technology), Trio (H-120, 1:1000, Santa Cruz Biotechnology), presenilin-1(PS1) (16163-1-AP, 1:1000, ProteinTech Group), β-actin (66009-1-AP, 1:1000, ProteinTech Group), LaminA/C (10298-1-AP, 1:1000, ProteinTech Group) or ATP1A1 (14418-1-AP, 1:1000, ProteinTech Group) were followed by fluorescently labeled antimouse or -rabbit antibodies (LI-COR Biotechnology, Lincoln, NE) and imaged using the Odyssey infrared imaging system (LI-COR Biotechnology). Quantification was performed using ImageJ.
Co-immunoprecipitation
After protein extraction with special lysis buffer, protein concentrations were measured by BCA assay. A total of 500 μg of the cell lysates was incubated at 4°C by gently rocking with 5 μg of anti-Notch1 or anti-Trio antibody for 12 hours. Then protein A/G agarose beads (catalog #9863, CST, USA) was added to bind with the complex for 2 hours with gently shake at 4°C. Co-immunoprecipitates were then magnetically separated, washed 3 times in lysis buffer, and finally revealed by Western blot analysis. Rabbit normal IgG (Santa Cruz) served as negative control.
RT-qPCR
Total RNA was extracted from endothelial cells using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. Complementary DNA was synthesized using the PrimeScript RT reagent Kit with gDNA Eraser (TaKaRa, Dalian, China). Afterwards, 20-uL reactions with primers (GENEWIZ Inc., South Plainfield, USA) were detected by Light Cycler 480II (Roche, Basel, Switzerland) using SYBR Green PCR Master Mix (Applied Biosystems, Waltham, USA). The mRNA expression levels were calculated using 2−ΔΔCT methods. The expression levels of PS1 was normalized to the expression of GAPDH.
The primers were as follows: PS1, forward, 5'- CATTATCTAATGGACGACCCCA -3' and reverse, 5'- AATGGGGTATAGATTAGCTGCC -3'; GAPDH, forward, 5'-CGAGATCCCTCCAAAATCAA -3' and reverse, 5'-TGTGGTCATGAGTCCTTCCA -3'.
Statistical Analysis
Data are expressed as the mean±SEM. Statistical analyses were performed using GraphPad Prism 7.0 or Microsoft Excel. Two independent sample data sets were tested using 2-tailed Student t test. Multiple comparisons utilized one-way ANOVA followed by Student-Newman-Keuls test. P<0.05 was considered to be statistically significant.