Site description and soil properties
A two-year field experiment was set up in a traditional, unheated and commercial solar protected field (80 m ⋅ 8 m) at Daxing district (39.67 N, 116.57 E), Beijing, Northern China. The soil texture in 0–30 cm was sandy loam (sandy loam in 30–60 cm and clay in 60–90 cm), with pH of 7.77, electrical conductivity (EC) of 1.22 mS cm− 1, 18.9 g OM kg− 1 dry soil, 1.08 g total N kg− 1 dry soil, 2 mg NH4+-N kg− 1 dry soil, 201 mg NO3−-N kg− 1 dry soil, 159 mg Olsen-P kg− 1 dry soil, and 437 mg available K kg− 1 dry soil (Table 1).
Table 1
Initial physicochemical properties of soil used in this study
Soil property | Depth (cm) |
0–30 | 30–60 | 60–90 |
Soil texture* | Sandy loam | Sandy loam | Clay |
Particle size (%) | | | |
Sand (2-0.05 mm) | 56 | 61 | 26 |
Loam (0.05 − 0.002 mm) | 29 | 19 | 2 |
Clay (< 0.002 mm) | 15 | 20 | 73 |
pH | 7.77 | 8.01 | 8.19 |
Electrical conductivity (mS cm− 1) | 1.22 | 0.30 | 0.28 |
Organic matter (g kg− 1 dry soil) | 18.9 | 4.3 | 3.1 |
Total nitrogen (g kg− 1 dry soil) | 1.08 | 0.54 | 0.35 |
Nmin (mg kg− 1 dry soil) | 203 | 113 | 83 |
Olsen-P (mg kg− 1 dry soil) | 159 | 45 | 10 |
Available K (mg kg− 1 dry soil) | 437 | 184 | 77 |
* According to the USDA's soil texture classification system. |
Crop management and experimental setup
Figure 1 presents the crop management and experimental setup in this study. From July to September was the summer fallow season. In 2014, sorghum (Sorghum bicolor (L.) Moench) was the summer CC. In 2015, sorghum (Sorghum bicolor (L.) Moench) and sweet corn (Zea mays) were directly seeded as the CC. The planting density of the sorghum and sweet corn was 55,555 plants ha− 1, with row spacing of 0.6 m and plant spacing of 0.3 m. There was only one over-winter cropping season per year. Eggplant (Solanum melongena) was the sole crop alternately. At the start of over-winter season, four-week-old eggplant seedlings were transplanted into double rows (wide: 0.9 m; narrow: 0.6 m) by hand in 22/9/2014 and 6/10/2015. The planting density of the eggplant was 29,600 plants ha− 1 with 0.5 m plant spacing. In 11/6/2015 and 9/6/2016, the harvest of the eggplant was completed. After harvest, the eggplant vines were removed from the protected field to lower the likelihood that disease would spread to the following crop.
In 2014, two treatments with three replicates were established in a randomized block design: 1) CK (fallow), 2) CC-S (sorghum as the CC). The CC treatment (CC-S) was split to compare the effects of sorghum and sweet corn in 2015, resulting in three treatments: 1) CK (fallow), 2) CC-S (sorghum as the CC), and 3) CC-SC (sweet corn as the CC). Each plot size was 48 m2 (6 m × 8 m). In the CC-S and CC-SC treatments, sorghum or sweet corn residues were broadcasted on the soil surface as basal fertilizer (40 t hm− 2), and then incorporated into the soil by plowing at the begining of the over-winter cropping season. Basal fertilizer was not applied in the CK treatment. During the over-winter cropping season, the top dressing (water-soluble chemical fertilizer) in each treatment was the same, supplying 867, 289, 578 kg ha− 1 of N, P2O5 and K2O respectively in 2014–2015, and 441, 260, 741 kg ha− 1 of N, P2O5 and K2O, respectively in 2015–2016 over-winter cropping season. The timing of top dressing was based on weather condition and cucumber cultivation in the investigated seasons. Recommended fertigation technique, drip irrigation, was applied in all treatments, with the irrigation rates of 428 mm and 538 mm in 2014–2015 and 2015–2016 over-winter cropping season, respectively (see Figure S1 for details).
Sampling and analysis
Eggplant yield
The eggplant crop was harvested on 11/6/2015 and 9/6/2016. Eggplants were weighed immediately after harvest and total fresh yield was calculated as t ha− 1.
Soil ammonium and nitrate concentrations, total nitrogen, phosphorus and potassium
Soil cores (diameter: 3 cm) were taken from each treatment to a depth of 30 cm at 24 and 70 days after CC planting and 1, 3, 8, 16, 31, 69, 262 days after eggplant transplanting in 2014–2015 growing season (summer fallow and over-winter seasons). In the growing season of 2015–2016, soil cores (diameter: 3 cm) were taken from each treatment to a depth of 90 cm and soil samples were obtained at the 0–30 cm, 30–60 cm, and 60–90 cm soil layers at 46, 68 days after CC planting and 247 days after eggplant transplanting (at harvest of eggplant). 6 g sieved (2 mm mesh) subsamples were extracted by shaking for one hour at 200 rpm with 100 mL of 1 mol L− 1 KCl. Extractable NH4+-N and NO3−-N concentrations were measured with a continuous flow analyzer (AA3, Seal, Germany) (Mulvaney 1996; Miranda et al. 2001). After harvest of CC in 2015, soil samples were taken from the 0–30 cm, 30–60 cm and 60–90 cm soil layers in order to analyze pH, EC, OM, total N, P, K, moisture content, NH4+-N and NO3−-N concentrations as the methods outlined in the study of Marsden et al. (2015).
Soil nitrification potential
After the summer fallow season, soil samples from each treatment were obtained at a depth of 30 cm for the soil nitrification potential analysis (Norton and Stark 2011). 5 g sieved fresh soil (preconditioning at 15°C for two weeks with 50% of field water capacity) was added to a 200 ml flask, and then 50 ml 1 mM phosphate buffer (pH = 7.2) containing 1.5 mM NH4+ was added to the flask. Flasks were incubated for 48 h at 180 rev min− 1 at 30°C. During the incubation, soil samples were sampled at 6, 12, 24, 36, 48 h. The NO2− -N and NO3− -N concentrations were then measured with an ultraviolet-visible spectrophotometer and a continuous flow analyzer, respectively.
DNA extraction and quantitative polymerase chain reaction
After harvest of CC in 2014 and 2015, soil samples (2014: 0–30 cm soil layer; 2015: 0–30, 30–60 and 60–90 cm soil layers) were collected to determine AOA and AOB amoA gene abundances. According to the manufacturer’s instructions, soil DNA was extracted using MO BIO Power Soil DNA Extraction kit from MO BIO Laboratories in Carlsbad, CA, USA. After extraction, DNA quality was evaluated by the ratio of A260/280 and A260/230 using a NanoDrop spectrophotometer, and DNA concentrations were quantified with Qubit assay (Invitrogen, CA). AOA amoA gene was amplified by using the polymerase chain reaction (PCR) primers amoA-AF (STAATGGTCTGGCTTAGACG) and amoA-AR (GCGGCCATCCATCTGTATGT) with the identical thermal profile as Francis et al. (2005). Each reaction contained 12.5 µl of Platinum SYBR Green JumpStart Taq ReadyMix (Invitrogen, Carlsbad, CA, USA), 0.6 µl of each primer at a concentration of 10 µM, 1 µl of bovine albumin at a dose of 8 µg µl− 1, 1 µl of ten times-diluted DNA template and 9.3 µl of sterile deionized water. PCR amplification of AOB amoA gene was carried out using the primer pairs: amoA-1F (forward) (GGGGTTTCTACTGGTGGT) and amoA-2R (reverse) (CCCCTCKGSAAAGCCTTCTTC) (Rotthauwe et al. 1997). Each reaction was made up of 12.5 µl of Platinum SYBR Green JumpStart Taq ReadyMix (Invitrogen, Carlsbad, CA, USA), 0.8 µl of 10 µM of each forward and reverse primer, 1 µl of 8 µg µl− 1 of bovine albumin, 2 µl of ten times-diluted DNA template, and 7.9 µl of sterilized deionized water. Real-time quantitative PCR (QPCR) was conducted by using an ABI7500 (Applied Biosystem, Foster City, CA, USA) with the following thermal profile for amplification: 5 min at 95°C; 40 cycles of 30 s at 95°C, 30 s at 57°C and 60 s at 72°C.
Statistical analysis
To ascertain the treatment effects on eggplant yield, NH4+-N and NO3−-N concentrations, soil nitrification potential, AOA and AOB amoA gene abundances, one-way analysis of variance (ANOVA) was performed following least significant difference (LSD) test at the 0.05 level. Spearman correlation analysis was conducted to relate soil parameters, mineral N, nitrification potential, AOA and AOB amoA gene abundances. Statistical analysis was performed using SPSS Statistics 27.0 (IBM Inc., Armonk, NY, USA).