Cells, reagents and solutions
Ramos, CHO-K1, HEK 293, HEK293T and HeLa cell line were purchased from the Korean Cell Line Bank. Raji cell line was gifted from Prof. Seong Hwan Kim (Chungnam National University, Daejeon). CHO-K1, Ramos and Raji Cells were maintained in RPMI1640 media supplemented with 10% FCS and 1% penicillin/streptomycin at 37°C, 5% CO2. HEK293T and HeLa cells were maintained in DMEM high glucose media supplemented with 10% FCS and 1% penicillin/streptomycin at 37°C, 5% CO2. For cell cultures, DMEM culture medium (Dulbecco’s modified Eagle medium, 11995-065), RPMI 1640 (Roswell Park Memorial Institute medium, 11875-093), Fetal bovine serum (FBS) (26140-079), Penicillin-streptomycin (15140-122, Gibco, Life technologies™, Carlsbad, CA, USA); Trypsin-EDTA 0.05% solution (25300-062, Gibco, Life technologies™, Carlsbad, CA, USA) were used. For immunoblotting, NaCl (S7653), Triton X-100 (T8787), Glycerol (G5516, Sigma Aldrich); EDTA (15694, Usb, USB Corporation, Cleveland, OH, USA); Tris Ultrapure (T1501, Duchefa, Haarlem, The Netherlands), Complete proteinase inhibitors (Roche Applied Science, Mannheim, Germany), HCl (084-05425), NaOH (196–05375, Wako, Osaka, Japan); BCA Protein Assay Kit (23227, Pierce™, ThermoScientific, Rockford, IL, USA), 5x sample buffer, pre-made 10% SDS-PAGE gels (KG7040) (KOMA Biotech, Seoul, Korea) were used. For immunocytochemistry, 4% paraformaldehyde (19943), BSA (10857, Affymetrix, Cleveland, Ohio, USA), phosphate-buffered saline (PBS) (P5493, Sigma Aldrich) were used.
Antibodies
Mouse anti-TNFR1 antibody (sc-8436, Santa Cruz Biotechnology), mouse anti-CD20 antibody (sc-393894, Santa Cruz Biotechnology), anti-GAPDH antibody (sc-47724, Santa Cruz Biotechnology), a horseradish peroxidase (HRP) conjugated goat anti-mouse antibody (115-035-003, Jackson Laboratories, PA, USA), FITC-conjugated goat anti-Human IgG antibody (109-095-003, Jackson Laboratories), Alexa Fluor 647-conjugated goat anti-mouse IgG antibody (115-605-006, Jackson Laboratories), Alexa Fluor 680-conjugated goat anti-mouse IgG antibody (115-625-146, Jackson Laboratories), Rituximab (Mabthera, Roche, Basel, Switzerland) were used. Obinutuzumab, anti-TNFR1 antibody (ATROSAB), anti-CD20 / TNFR1 bispecific antibody, Obi-TNFαWT and OBI-TNFαMUT were produced in our laboratory. Fab region of a humanized antagonistic anti-tumor necrosis factor receptor on-specific antibody (ATROSAB) was used to generate anti-CD20 / TNFR1 bispecific antibody (36). R1antTNF, a TNFR1-selective antagonistic mutant TNF containing mutations A84S, V85T, S86T, Y87H, Q88N and T89Q was used as TNFαMUT to generate OBI-TNFαMUT (35).
Immunoblotting
Cells were rinsed with cold PBS and lysed in RIPA buffer (150 mM NaCl, 50 mM Tris-HCl (pH 8.0), 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS (10%) and proteinase inhibitor (Complete, Roche Applied Science)) at 4°C for 20 min. Cell lysates were cleared by centrifugation at 17,000 ×g for 20 min at 4°C. Transfer only the supernatant and quantify total protein by BCA quantification. Cell lysate samples were prepared by adding 5×sample buffer, heated at 95°C for 5 min, separated by 10% SDS–PAGE gels and then transferred to a nitrocellulose membrane. The part other than the protein electrically delivered to the NC membrane was blocked with TBS-T containing 5% non-fat milk for 1 hr at room temperature. The primary antibodies, mouse anti-TNFR1 (sc-8436, Santa Cruz Biotechnology), mouse anti-CD20 (sc-393894, Santa Cruz Biotechnology), anti-GAPDH antibody (sc-47724, Santa Cruz Biotechnology) diluted in TBS-T containing 2% BSA were added and incubated at 4°C overnight. The membrane was then rinsed and incubated for 1 h at room temperature with a horseradish peroxidase (HRP) conjugated goat anti-mouse antibody (115-035-003, JACKSON Lab, PA, USA). After rinsing, protein bands were visualized with Super Signal West Femto Luminol/enhancer solution (TC263618, ThermoScientific) and captured digitally using the chemi-luminescent Image Analyzer (LAS 4000 mini, Fujifilm).
Quantification of membrane protein expression
Ramos and Raji cell lines were resuspended in PBS and blocked with Human TruStain FcX™ (422301, Biolegend) for 10 min. Cells were treated with primary antibodies, PE anti-human CD120a (369903, Biolegend) and APC anti-human CD20 (302309, Biolegend) and incubated for 30 min at 4°C. After washing, a total of 10,000 cells were counted by flow cytometry (FACS, BD Biosciences, Franklin Lakes, NJ, USA) and analyzed with FlowJo software.
Immunocytochemistry
Before or after Ramos cells were treated with Obinutuzumab, fixed with 4% paraformaldehyde in PBS for 10 minutes at room temperature then rinsed three times with PBS. Cells were incubated with a blocking solution (5% horse serum, 1% BSA, 0.1% gelatin, 0.001% sodium azide in PBS pH7.4) for 30 minutes at room temperature. After rinsing twice with PBS, cells were incubated with mouse anti-TNFR1 antibody (sc-8436, Santa Cruz Biotechnology) in 1% BSA at room temperature for 1 hr, rinsed three times with PBS and incubated with FITC-conjugated goat anti-human IgG Fc-specific secondary antibody and Alexa680-conjugated goat anti-mouse Fc specific secondary antibody for 30 min at room temperature in the dark. Cells were rinsed three times, mounted with fluorescent mounting medium (S3023, Dako, Glostrup, Denmark), and visualized on a confocal microscope (LSM 780 controlled with Zen software; Carl Zeiss, Jena, Germany).
Lentivirus production
All proteins and antibodies were stably expressed through lentiviral infection. Lentiviruses were produced by co-transfecting HEK293T cells with a lentiviral expression cassette and packaging plasmids (pMD2.5G (12259, Addgene) and psPAX2 (12260, Addgene)) using PEI (polyethylenimine) (23966-1, Polysciences, PA, USA) transfection reagent. Viral supernatant was collected 24 hr after transfection, centrifuged at 1,000 ×g for 5 min and filtered with a 0.45 µm syringe filter.
Antibody plasmid construction
For the sequence of anti-TNFR1 antibody (ATROSAB), refer to patent #US8859739B2. The variable region of the heavy chain and light chain was synthesized from Genscript (#U6260EL230). Light chain is inserted to pLVX viral vector by Xba1, heavy chain variable region to pLVX viral vector that already have heavy chain constant region by Xba1 and Nhe1. For anti-CD20 / TNFR1 bispecific antibody construct, anti-TNFR1 antibody heavy chain including Q39K, K62E, H172A, F174G, T366S, L368A, Y407V and light chain including D1R, Q38D, L135Y, S176W were synthesized from Genscript. In obinutuzumab region, heavy (Q39Y, T366W) and light chain (G38R) mutations were mutated by site-directed mutagenesis. Mutation primer is determined using primer X program. For heavy chain Q39Y mutation, primer TTGTCCAGGGGCGTACCGCACCCA and AACTGGGTGCGGTACGCCCCTG GA, for heavy chain T366W mutation, primer GAAGCCTTTGA CCAGGCACCACAG and CAAGA ACCAGGT CAGCCTGTGGTG, for light chain G38R mutation, primer CTGCCCT GGCTTTCT CAGGTACCA and GTA TTG GTA CCT GAG AAA GCC AGG were used. DNA sequences were validated by sequencing. For OBI-TNFαWT, 2 inserts (obinutuzumab HC, GSGSG linker + soluble TNFα (aa77-233)) were ligated with BamH1 and ligated into pLVX-CIP vector with Xba1 and Not1. GSGSG linker + soluble TNFα was constructed by extension PCR. Primer CGGGATCCGGCAGCG GCGTCAGATCATCTTCTCGAAC and GTTCGAGAAGATGATCTG ACGCCGCTGCCGGATCC CG, CGGGATCCGGCA GCGGCGGATCTGGTAGCGGCGTCAGAT CATCTTCTCGAACC and GGTTCGAGAA GATGATCTGACGCCGCTACCAGATCCGCCGCTGCCGGATCCCG, CGGGATCCGGCAGCGGCGGATCT GGTAGCGGCGGGAGCGGGTCAGGCGTCAGATCATCTTCTCGAACC, GGTTCGAGAAGATGATCTGA CGCCTGACCCGCTCCCGCCG CTACCAGATCCGCCGCTGCC GGATCCCG were used. For OBI-TNFαMUT, soluble TNFαMUT (A210S, V211T, S212T, Y213H, Q214N, and T215Q) was generated by site-direct mutagenesis using OBI-TNFαWT template and primer AGCCGCATCAGCACCACCCACAAC CAGAAG GTCAAC and GTTGACCTTCTGG TTGTGGGTGGTGCTGATGCGGCT were used.
Generation of antibody producing CHO cells
CHO-K1 cells were plated in 12 well plates for 24 hr. To generate Obinutuzumab, anti-TNFR1, OBI-TNFαWT and OBI-TNFαMUT fusion proteins, cells were incubated with lentivirus containing antibodies HC, LC vectors in a ratio of 3:2 with 10 µg/ml polybrene (TR-1003-G, Sigma Aldrich) for 24 hr. After removal of viruses, cells were selected by incubating fresh medium containing 10 µg/ml puromycin (ant-pr-1, Invivogen), 20 µg/ml blasticidin S (ant-bl-05, Invivogen) for 72 hr. To generate anti-CD20 / TNFR1 bispecific antibody, cells were incubated with lentivirus containing obinutuzumab HC Mutant, LC Mutant, anti-TNFR1 HC Mutant, LC Mutant vectors in a ratio of 3:2:3:2 with 10 µg/ml polybrene (TR-1003-G, Sigma Aldrich) for 24 hr. After removal of viruses, cells were selected by incubating fresh medium containing 10 µg/ml puromycin (ant-pr-1, Invivogen), 20 µg/ml blasticidin S (ant-bl-05, Invivogen), 200 µg/ml hygromycin B (H0192, Duchefa Biochemie), 400 µg/ml G418 (ant-gn-1, Invivogen) for 72 hr. After selection, enough stable cells are secured by proliferating the remaining cells.
Antibody production and purification
Antibody-producing cells grown to 80% confluence in full media were rinsed twice with PBS and refreshed with CD CHO Medium (10743029, Gibco, Life technologies TM, Carlsbad, CA, USA) containing 8 nM L-glutamine (25030081, Gibco, Life technologiesTM) and 1 mM sodium butyrate (LS 033 − 01, WELGENE, Daegu, Korea). Conditioned media containing antibodies were obtained by further incubation for 2 weeks at 30°C in 5% CO2. Antibodies were purified via affinity chromatography using Pierce Protein A Agarose (20333, Thermofisher). The antibody-containing media was incubated with protein A agarose bead at 4°C for 24 hr. The beads were centrifuged and washed 3 times with a washing buffer (0.1 M NaPO4, 0.15 M NaCl, pH 7.4). Antibodies were eluted with elution buffer (0.2 M glycine, pH 3). The eluted antibody was dialyzed against 1 L PBS for 6 hr at 4°C twice and concentrated with Amicon® Ultra-15 Centrifugal Filter Units (UFC900324, Merck, 3K). Total antibodies were quantified by NanoDrop™ Lite Spectrophotometer. After quantification, 1 µg antibodies were added with 5× laemmli sample buffer and separated by 10% SDS-PAGE gels and stained with Coomassie blue.
Stable cell line construction
Human MS4A1 and TNFRSF1A cDNA in pCNS vector were purchased from Korean human gene bank. The full cDNA sequences of MS4A1 and TNFRSF1A were cloned into the pLVX lentiviral vector with Xba1. TNFRSF1A Δ CD (lacking cytoplasmic domain (aa233-455)) was cloned into the pLVX lentiviral vector with Nhe1 and Not1. Primers CCCGCTAGCATGGGCCTCTCCACC and GGGCGGCCGCTTAGTAGAGCTTGGACTTCC ACC were used. Lentiviruses were produced as previously described. To generate HeLa cell stably overexpressing CD20 or TNFR1ΔCD and Raij cell stably overexpressing empty vector (EV) and TNFR1, HeLa and Raji cells were plated in 12-well plates with 10 µg/ml polybrene (TR-1003-G, Sigma Aldrich) and incubated with virus-containing medium for 24 hr. Viruses were removed and cells were supplemented with fresh medium containing 1 µg/ml puromycin (ant-pr-1, Invivogen) for 48 hr. Protein expression was confirmed by flow cytometry and immunoblotting.
Cell binding assay
Ramos and HeLa-CD20, TNFR1 ΔCD cells were resuspended in PBS and incubated with the indicated dose of antibodies at 4°C for 30 min. Cells were rinsed twice with PBS and incubated with a FITC-conjugated anti-human Ig Fc-specific secondary antibody (109-095-003, Jackson Laboratories) at 1:500 dilutions for 30 min. After being rinsed twice with cold PBS, a total of 10,000 cells are counted by flow cytometry (FACS, BD Biosciences, Franklin Lakes, NJ, USA) and analyzed with FlowJo software.
Direct cell death assay
To measure antibody-induced direct cell death, 1 × 105 cells were resuspended in full media and then incubated with the indicated dose of antibodies (7, 21, and 70 nM) for 6 hr. Then, cells were stained with PI (Propidium iodide) for 20 min in 37°C. % of direct cell death PI + cells among 10,000 counted total cells were calculated by FACS Verse (FACS, BD Biosciences, Franklin Lakes, NJ, USA) and analyzed by Flow Jo software.
Lysosomal membrane permeability assay
To measure lysosomal membrane permeability, cells were resuspended in full media and then incubated with the indicated dose of antibodies for 1 or 2 hr. Then, cells were stained with lysotracker™ deep red (50uM) for 30min. % of lysotracker positive cells among 10,000 counted total cells were calculated by FACS Verse (FACS, BD Biosciences, Franklin Lakes, NJ, USA) and analyzed by Flow Jo software.
PBMC and primary B cell isolation
Peripheral blood mononuclear cells (PBMC) were purified from healthy donors who voluntarily participated in this study, for which informed consent was obtained to the study contents. All of these processes were conducted in accordance with the IRP procedure (#4-2016-0600) approved by the Yonsei University Institutional Review Committee. The blood is mixed with PBS in a 1:1 ratio and piled up on the tube where ficoll (HISTOPAQUE-1077, Sigma, 10771) was put in advance. White blood cells and red blood cells were separated by centrifugation at 25°C for 400×g and 30 min, collected and transferred to a new tube. Cells were rinsed twice with PBS and centrifuged at 300×g for 10 min at room temperature. This process was repeated twice to completely remove the platelets. Then, PBMC were resuspended in RPMI full media to be counted and used. Primary human B cells were isolated from PBMC using the B cell isolation kit II (130-091-151, Miltenyl Biotec) following the manufacturer’s protocol.
Gene-expression datasets
The whole expression data set consisting of 873 biopsy specimens studied by means of Affymetrix HG-U133A GeneChip microarrays was collected as part of the German MMML consortium (Molecular Mechanisms in Malignant Lymphoma). The complete normalized data and follow-up information are available from ‘The Leipzig Health Atlas’ repository under accession number 7VT47TM4GV-1 (https://www.health-atlas.de/index.php/en/lha/7VT47TM4GV-1). They divide into reference samples (tumor cell lines, sorted B cells, tonsils), mature B cell lymphomas and other tumors collected in the study. One of the lymphoma specimens was measured twice on two arrays. Tumors were diagnosed in panel meetings of the MMML pathology group. Normal B cells were isolated from peripheral blood samples of healthy individuals. For isolation of the B cell subsets, FACS sorting employing antibodies against CD19 and IgD (naïve B cells), and CD19 and CD27 (post GC memory B-cells) was used.
Antibody dependent cellular cytotoxicity assay
Ramos and Raji cells were washed with PBS and stained with 0.25 µM calcein-AM. Cells were incubated for 30 min and rinsed twice with RPMI full media. Purified PBMC (effector: target = 5 : 1) were added and cells were treated with the indicated dose of antibodies (7, 70 nM) and incubated at 37°C in 5% CO2 for 4 hr. The % of FITC + cells among total 60,000 PBMC was calculated by FACS Verse (FACS, BD Biosciences, Franklin Lakes, NJ, USA) and analyzed by FlowJo software. Normalization was done by ADCC % = 100 – (% of Treated/Untreated live cell population) *100
TNFR1 signaling reporter assay
NF-κB promoter-dependent GFP reporter HEK293 cells were gifted from Prof. Jinu Lee (Yonsei University College of Pharmacy, Korea). Reporter cells were rinsed once with PBS, seeded 5 × 104 cells per well in a 96-well plate and incubated for 24 hr. In the antibody dose-dependent TNFα-induced NF-κB signaling activation assay, cells were incubated with the indicated dose of antibodies (0, 0.1, 0.3, 1, 3, 10 nM) for 24 hr. In the antibody-dependent TNFα-induced NF-κB signaling blockage assay, cells were pre-treated with the indicated dose of antibodies (70 nM) before 30 min, and then incubated with 20 ng/ml TNFα at 37°C for 24 hr. Cells were rinsed once with PBS and detached with Versene solution (15040066, Gibco Life Technologies™). Cells were rinsed with PBS and plated on a 96-well opaque plate. The fluorescence intensity of GFP per well was measured using a microplate reader (Flexstation 3, Molecular Devices) with an excitation/emission of 488 nm/520 nm. For normalization, cells were lysed with Triton X 2% and stained with PI staining. The fluorescence intensity of PI per well was measured using a microplate reader (Flexstation 3, Molecular Devices) with an excitation/emission of 518 nm/620 nm.
Statistical analysis
Statistical analyses were performed using Prism v9 (GraphPad Software). Data are presented as the means ± standard deviation as indicated in the figure legends. Statistical significance was assessed by Student’s multiple unpaired t-test. For Fig. 4A, B, Statistics were calculated using One-way ANOVA followed by Dunnett’s multiple comparisons tests. Significance is indicated as follows: *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.