2.1. Ethical statement
All the patients were properly informed about the research of study and written informed consent was obtained from all the patients. Most human researches are conducted according to ethical standard declaration of Helsinki (24). The study was conducted after the approval of synopsis from Board of study and Advance study research board (ASRB), Department of Medical Laboratory Technology, The University of Haripur.
2.2. Sample collection
The whole blood samples were collected from conform MPN patients according to WHO criteria at Rehman Medical Institute (RMI) and Institute of Basic medical Science, Khyber Medical University (IBMS-KMU) Peshawar KP. Proper informed consent was taken from all participants. A total of 4 ml of blood were collected from all participants in aseptic condition and DNA was extracted from blood samples.
2.3. DNA extraction
QIAamp Blood mini kit (Qiagen) was used for the extraction of DNA as per manufacturer guidelines. The Principle of DNA extraction is based on silica membrane column and performed as described previously (25).This method gave higher concentration of DNA yield and easy to extract DNA as per manufacturer instructions.
2.4. Primers and probe design
Newly synthesized primers were used in the current study. The JAK2 gene exon 14 region was used to generate primers.Wild type forward primer CATTTGGTTTTAAATTATGGAGTATGTG, mutation V617F specific forward primer CATTTGGTTTTAAATTATGGAGTATGTT, common reverse primer CTGACACCTAGCTGTGATCCTG and common probe FAMTGCCTTTCTCAGAGCATCTGBHQ1. The primers and probe were manufactured by Molecular Biology Products (Eurofins-USA). For internal control, the following forward (TGCTGAAAGTAGGAGAAAGTGC) and reverse (CCTACAGTGTTTTCAGTTTCAAAAA) were used.
2.5. Optimization of the Real Time PCR amplification conditions
The Real-time PCR was done using ABI-7500 thermal cycler. The current method uses a single pair of primers and probe used in optimization. First, in the optimization phase, DNA from positive cases was used. Reaction mixture for PCR had 10 µl TaqMan Universal PCR Master Mix (Applied Biosystems), 0.6 µl of each primer, 0.6 µl of probe, 2 µl of DNA and 6.2 µl PCR water giving final volume of 20 µl reaction mixtures. The above reactions were added to PCR plate and covered with a clear PCR plate sealing film. The ABI 7500 Real-Time PCR systems (Applied Biosystems) was used for qPCR tests using 40 CT cycles each reaction. RQ manager software (Applied Biosystems) was used to analyze results. The PCR reactions was performed according to the following conditions; initially holding stage at 50ºC for 2 minutes, 2nd holding stage at 95ºC for 10 minutes, cycling stage at 95ºC for 15 second and at 60ºC for 1 minute and cycling stage repeat for 40 cycles. Fluorescent signals were recorded, and were analyzed after PCR performed upon ABI-7500.
2.6. Assay validation
TaqMan q-PCR probe was tested for inter and intra-assay reliability using 1 mutant JAK2-V617F and 1 wild-type samples, these samples were run in 2 and 10 replicates respectively, tested in multiple experiments. Thermal cycler ABI-7500 was used for real time PCR throughout the study.
2.6.1. Generation of standard
In-vitro synthesized target sequence (Kinco Biological) was cloned in bacterial plasmid for mutant DNA sequence having 161-bp lengths. The control containing 4µg of transformed plasmid was delivered. The control containing 100% of plasmid DNA was used as a positive control and for development of standard curve. For negative control, pooled DNA from 20 healthy individuals was used.
2.6.2. Standard curve development
The standard curve was developed by using transformed-plasmid. The 100% transformed-plasmid containing mutant sequence was serially diluted. For internal control, the following forward (TGCTGAAAGTAGGAGAAAGTGC) and reverse (CCTACAGTGTTTTCAGTTTCAAAAA) were used.
2.6.3 Analytical sensitivity and specificity
Serial dilution of DNA was made to test the sensitivity of the assay. Dilutions of 1:1, 1:2, 2:4, 1:8, 1:16 and 1:32 were used for JAK2-V617F DNA having wild-type DNA with a reproducible limit of detection (LOD) of 5% mutation positive DNA. Our optimized assay proved 99% specificity and 98% accuracy.
2.7. Statistical analysis
Data were analyzed by the help of SPSS software (Statistical Package for the Social Sciences Inc. Chicago, Illinois USA, version22).Quantitative data analysis was performed on GraphPad Prism 6.0 (GraphPad software, Inc., La Jolla, CA, USA). Cross tabulation were applied to the study variables.