Genetic diversity of indigenous bitter gourd (Momordica charantia L.) genotypes by morphological and molecular marker

doi:10.21203/rs.3.rs-1979192/v1

Bitter gourd (Balsam pear, Momordica charantia L.) belongs to the family Cucurbitaceae, known for its health promoting benefits. It is widely grown in Asian countries due to its medicinal property, especially in China, India and Southeast Asia. Bitter gourd shown wide diversity for fruit morphology which varies greatly in color, shape, size, and yield attributing traits. The diverse morphological characters of M. charantia provide relatively broad phenotypic variation. Genetic diversity assessments and linkage map construction can increase the effectiveness of breeding programs. This study was conducted to evaluate and characterize the exotic accessions to define their relationship based on Indigenous accessions having some commercial cultivars of economic importance. The mean sum of square was highly significant for all traits indicating the presence of wide range of variability in the genotypes. The results showed that there were significant differences among the genotypes for all the traits under studied. The best genotypes identified from the study were Pusa Aushadhi for earliness, Gangajalee small for number of fruit /plant, BRBTL for average fruit weight and yield/plant and the genotype Konkan tara found best for biochemical traits. Molecular diversity analysis was also carried out using 35 SSR primers, out of which eleven primers showed polymorphism among 21 genotypes. The polymorphism % ranged from -44.11 to 0.97% indicating wide variation for earliness, shape and biochemical traits in genetic diversity. A Dendrogram was constructed by UPGMA analysis revealed four cluster. These markers effectively segregated the genotypes based on genotypic character hence, can be used for both morphological and molecular diversity analyses for further breeding applications.

Bitter gourd

PCV

GCV

Heritability

Diversity

SSR marker

Bitter gourd (balsam pear, Momordica charantia L.) belongs to the family Cucurbitaceae, having several health promoting benefits. It is widely grown in Asian countries due to its medicinal importance, especially in India and Southeast Asia. Bitter gourd shows wide diversity especially the fruit morphology varies greatly in color, size, and exocarp characteristics. The large fruited commercial types have been derived from small fruited types, by virtue of their large and heavy fruits, have higher potential than small fruited semi domesticates have practically escaped the attention of breeders (Joseph 2007). In contrast, three distinct types occur in China; ecotypes bearing small (10-20 cm) extremely bitter fruits; those which develop comparatively long (30-60 cm) slightly bitter fruits; and ecotypes which produce moderately to strongly bitter 9-12 cm long, triangular or cone-shaped fruit (Yang and Walters 1992). In Southeast Asian, small ecotypes enjoying worldwide cultivation are botanically designated as M. charantia var. minima Williams & Ng (fruit <5 cm in diameter), and large M. charantia var. maxima Williams & Ng (fruit >5 cm in diameter) (Reyes et al., 1994). However, Chinese bitter gourd ecotypes are morphologically different from Indian types, and have not yet received botanical variety designations (Behera et al., 2007). It has been documented that bitter gourd contains the health promoting substances like charantin (hypoglycemic; Yeh et al, 2003), vicine (hypoglycemic), and momordicoside A and B (tumor growth inhibitors). The antimicrobial (Yesilada et al 1999), antifertility (Basch et al 2003), antiviral (Nerurkar et al 2006), and antiulcerogenic (Gurbuz et al 2000) activities characterized in bitter gourd have been attributed to a broad array of biologically active phytochemicals, including triterpenes, and steroids (Grover and Yadav 2004).

The center of domestication of bitter gourd likely lies in eastern Asia, possibly eastern India or southern China (Vujovic et al., 2000). However, no archaeological report of bitter gourd remains in China (Marr et al., 2004). A comprehensive compilation of plant remains from 124 Indian archaeological sites does not list bitter gourd. Due to unique set of Indo-Aryan words, it indicates that Aryans didn’t have information about bitter melon before entering India (Vujovic et al., 2000). The domesticated progenitor of wild bitter gourd accessions listed in floras of India, tropical Africa, and Asia as well as the New World tropics, where it first arrived in Brazil via the slave trade from Africa, and then spread into Central America (Marr et al 2004).

The diverse morphological characters of M. charantia provide relatively broad phenotypic variation. Genetic diversity assessments and linkage map construction can increase the effectiveness of breeding programs (Fan et al 2006). This study is, therefore, designed to evaluate and characterize exotic accessions and define their relationship with Indigenous accessions and to the commercial cultivars of economic importance.

The experimental materials comprised of twenty-one indigenous lines of bitter gourd (Table 1). The local genotypes were maintained at department of horticulture (vegetable and floriculture), Bihar Agricultural University, Sabour whereas other lines were obtained from IARI, New Delhi and other part of India. The experiment was laid out in a Randomized Complete Block Design with 3 replications for phenotypic evaluation at the Vegetable research farm department of horticulture (vegetable and floriculture), Bihar Agricultural University, Sabour during spring–summer (dry) seasons of year 2014-15. The field was irrigated and then the recommended dose of fertilizer and agronomic practices were done to raise a successful crop during the spring-summer seasons of given years. Seeds were sown on both sides of the channel with a spacing of 2.5 m between row-row and 60 cm between Plants. The fruits were harvested at marketable stage. Five plants were selected for taking observation after discarding the border plants at both ends and were examined for 17 traits viz., node no.1st staminate flower, node no.to 1st pistillate flower, days to 1st staminate flower anthesis, days to 1st pistillate flower anthesis, days to 50% flowering (nffi) node no.to 1^st fruit initiation, (dffh)-days to 1^st fruit harvest, 8. -(vl) vine length, (id)- internodal length, (npb/v)-no. of primary branches/vine, no of fruits/vine, fruit diameter (cm), fruit length (cm), fruit weight (gm), no of seeds/fruits, fruit fly infestation, fruit yield (g/plant), Ascorbic acid (mg/100g), Titrable Acidity (%), Total carotenoid (mg/100 g), Total Chlorophyll (%), Total Sugar (g/ 100 g), Total Phenol (mg CE/ 100 g FW), Flavonoids (mg/g) and Iron (mg/100g).

Data analysis

The data were subjected to analysis of variance as per procedure described by Panse and Sukhatme (1967). The phenotypic and genotypic coefficient of variation were calculated according to Burton and De Vane (1953), heritability, genetic advance and genetic gain were calculated according to the formulae of Johnson et al. (1955).

Morphological and Biochemical analysis based on quantitative traits

The mean sum of square was highly significant for all traits indicating the presence of wide range of variability in the genotypes. The results showed that there were significant differences among the genotypes for all the traits under studied. The mean performance, range, standard error of difference and critical difference values are presented in Table 1. The node number to 1^st staminate flower (10.2), node number to 1^st pistillate flower (9.41), days to 1^st staminate flower anthesis (41.12) and pistillate flower anthesis (40.20), days to 50% flowering (38.12), days to 1^st fruit harvest (48.28), was observed early in accession Pusa Aushadhi (Table 1).The vine length (2.71) was observed maximum in bitter kathi (2.94). The internodal length (8.37) and number of primary branches/vine was recorded maximum in line-214(14.77) respectively. The fruit length was found maximum in Pallee (20.24) and fruit diameter was found maximum in BRBTL (14.52). Genotype Konkan tara bore highest number of fruits/plant (41.46) and BRBTL was found maximum fruit weight (144.45). Genotype preeti had highest fruit fly infestation whereas genotype Pusa Aushadhi had highest no. of seeds/fruit. The fruit yield/plant was found maximum in BRBTL (3761.3). The genotype preeti bored highest 50% flowering (54.17) whereas genotype swarnayamini had late fruiting (61.28). The result was in consonance with Resmi and Sreelathakumary, 2017 and Shukla et al, 2017 on different genotypes. The vine length was observed minimum in Pusa Rasdar (1.32) whereas internodal length (5.17), number of primary branches/vine (12.16) and fruit length was observed minimum in Konkan tara (4.66). The fruit diameter was found minimum in bitter kathi (3.01) whereas number of fruit/plant was observed minimum in line-314. Genotype gangajalee small was found minimum fruit weight (27.48) and lowest fruit fly infestation (17.49) whereas number of seeds/fruit was found minimum in line-514(8.49). The fruit yield/plant was found minimum in gangajalee small (1639.3).

The genotype Konkan tara was observed maximum for Vitamin C (640.21), acidity (2.119), and total carotenoid (1858.50). The total chlorophyll content was found maximum in Preeti (1.693) whereas total sugar (0.957) was found maximum in gangajalee small. Total phenol (9.17), and iron (0.917) was found maximum in BRBTW-1. The flavonoids content was observed maximum in swarnayamini. Vitamin C was found minimum in Line-114(43.03) whereas acidity was found minimum in bitter kathi. Total carotenoid was observed minimum in meghdoot (149.30) while total chlorophyll was found minimum in gangajalee small (0.453). Bitter kathi and Pirpaiti local was observed minimum total sugar (0.217). Total phenol was found minimum in jhalari (1.31). The Flavonoids content was found minimum in Pirpaiti local (8.67) whereas iron content was found minimum in Line-514 (0.267). Wide range of variation was observed for both morphological and biochemical traits. For morphological traits all characters except vine length and fruit diameter showing narrow range of variation. The widest range was recorded for yield per plant (1611.2-3218.7) followed by other morphological parameters. For biochemical traits all characters except acidity was showing narrow range of variation. The highest range was recorded for total carotenoid (1611.2-3218.7) followed by vitamin c, total sugar, total phenol, flavonoids (mg/g) and Iron (μg/g).

Highest genotypic coefficient of variation (GCV) for morphological traits was recorded for fruits length (130.50) followed by fruit diameter, fruit yield, length, fruit fly infestation, no. of seeds/fruit, vine length and internodal length, (Table 2). Moderate genotypic coefficient of variation was observed for traits like number of fruits/vine, node number to 1^st staminate flower, node number to 1^st pistillate flower, days to 1^st staminate flower anthesis, days to 50% flowering, days to first fruit harvest and number of primary branches/vine whereas the lowest GCV was observed for days to 1^st pistillate flower anthesis. The traits having higher range of variation have a better scope of improvement through selection. The phenotypic coefficient of variation (PCV) exhibited similar trend for the characters as in GCV and had higher value than GCV indicating that genotypic expression was superimposed by the environmental influence. The PCV was highest for fruit length (132.88) followed by fruit diameter, fruits weight, fruit yield, fruit fly infestation, no. of seeds/fruit, vine length and internodal length. Moderate phenotypic coefficient of variation was observed for traits like number of fruits/vine, node number to 1^ststaminate flower, node number to 1^stpistillate flower, days to 1st staminate flower anthesis, days to 50% flowering, days to first fruit harvest, days to 1^stpistillate flower anthesis and number of primary branches/vine, whereas the lowest PCV was observed for days to days to 1^st fruit harvest.Biochemical traits like Vitamin c (127.99) was showing highest genotypic coefficient of variation (GCV) followed by acidity, total carotenoid and total phenols. Moderate genotypic coefficient of variation was observed for total sugar, total chlorophyll and Iron (µg/g) whereas flavonoids was recorded lowest GCV. The phenotypic coefficient of variation (PCV) showed similar trend for the characters as in GCV but PCV had higher value than GCV for all the biochemical traits.

The heritability in broad sense was moderate to high (> 50%) for all morphological traits except number of primary branches/vine indicating the major role of genotypes in expression of these characters (Table 2). The estimate of heritability for morphological traits was highest for fruit weight (98.38) followed by fruit length, fruit fly infestation, fruit diameter, number of seeds/fruit, internodal length, days to first fruit harvest, fruit yield (g/plant), number of fruits/vine and vine length. The characters showing moderate values (50-80%) of heritability were node number to 1^st staminate flower, node number to 1^st pistillate flower, days to 50% flowering, days to 1^st staminate flower anthesis and days to 1^st pistillate flower anthesis. The estimate of heritability for biochemical traits was highest for vitamin C (100.01), followed by acidity, total carotenoid, flavonoids, iron, total phenol, total chlorophyll and total sugar. To estimate the accuracy of heritable variation, heritability must be estimated in association with genetic advance. Genetic advance was estimated at 5% selection intensity and converted into expected genetic gain as per cent of mean. Genetic advance for morphological traits was varied from 0.71 (vine length) to 1018.47 (fruit yield) whereas for biochemical traits it was varied from 0.31 (total sugar) to 324.47 (Vitamin C). Other characters showing high genetic advance (more than 5) for morphological traits were days to first fruit harvest, days to 50% flowering, fruit length, number of fruits/vine, fruit fly infestation and number of seeds/fruit whereas for biochemical traits characters showing high genetic advance (more than 1) were total carotenoid, and total phenols while (less than 1) were acidity, total chlorophyll, total sugar and iron. The genetic advance as percentage of mean for morphological traits ranged from 7.79 % for days to 1^st pistillate flower anthesis to 80.09 % for fruit weight whereas for biochemical traits it ranged from 55.58 for flavonoids to 842.52 for total carotenoid. High genetic advance as percentage mean were observed for morphological traits like fruit weight, fruit length, fruit fly infestation, number of seeds/fruit, vine length whereas for biochemical traits it was observed for Vitamin c, acidity, and total Phenols. Rest of the characters showed moderate to low value of genetic advance.

Molecular marker

The polymorphism evaluation for all the genotypes was carried out using DNA sample from 5 plants of individual genotype. A total of 35 primers were used for this purpose. Out of 35SSR primer, only 11 produced polymorphic bands (100%) and rest all other produced monomorphic bands. The primers, which produced polymorphic bands, selected to measure the diversity among 21 genotypes. These polymorphic primers can be regarded as reliable markers for further analysis of concerned genotypes. The size of the amplified products varied from 100bpto 300 bp.

Cluster analysis based on molecular markers

Based on UPGMA cluster analysis (Fig.1) the grouping of 21 genotypes in three major groups. Group I had the 19 genotypes. Group I can be further divided into two subgroups. Subgroup I can be divided into two clusters. All other 14 genotypes were represented in subgroup I. Very minor differences observed in sub group II. The subgroup II can further be divided into two clusters. The small cluster represented 5 genotypes.During the recent past, the development of new molecular marker systems has been successfully utilized for analysis of genetic diversity. Molecular markers are highly useful for identification of plant varieties and protection of plant breeders and farmers right. Among the molecular markers available, RAPD is simplest and efficient means for cultivar identification and diversity analysis (Williams et al 1990). The power of RAPD for analyzing genetic diversity has been well established in a wide range of vegetable crops including cucurbits. The most reliable, efficient and economic means for diversity analysis and cultivar identification are SSR markers. The present investigation is the first comprehensive study in bitter gourd utilizing SSR markers. The 40 primers used in the present analysis revealed polymorphism among 21 genotypes collected from different parts of India including some of the commercially released varieties by different institutes of India. The degree of polymorphism varies from 50 to 200 % whereas PIC value ranges from -44.11 to 0.97 which was relatively higher than any other marker used in bitter gourd. The genetic diversity in melon has average number of polymorphic bands per primer was 2.78. In the present study, the average number of polymorphic bands per primer was 2.78 which indicate that these identified primers are highly reliable and can further be used for evaluation of bitter gourd population.

The present studies showed that significant variation among the genotype for both qualitative and quantitative traits. It helps in selection of genotype on the basis of nature and magnitude of genotypes. These results were in agreement of Yadav et al 2013, Sidhuet al 2016 and Resmii and Sreelathakumary 2017 and confirmed the nature of genetic resource for yield and its component trait for future breeding effort. Biochemical traits have significant effect on fruit yield and pest infestations due to wide range of variation among qualitative traits. The finding was in consonance of Nath et al 2017 and Hamissou et al 2013. The experiment showed that value of PCV is greater than GCV indicate the effect of environment for expression of traits. The traits having highheritability and highgeneticadvance (fruit weight and Vitamin C) indicates that there was effect of additive gene effects and effective selection methodology was used. The above finding was in consonance of Pathak et al 2014 and Khan et al 2016. Effectve selection depends on high heritability and high genetic advance. The result was in support of Hachiman et al 2011 and Singh et al 2002.

Efficacy of marker analysis was needed to detect variation among different genotypes of bitter gourd collected from different parts of Bihar, Jharkhand, U.P and Maharashtra.Markers with repeat motifs were selected because they have displayed polymorphism in previous studies (Wang et al 2010). There was limited information about ssr marker in bitter gourd.SSR marker have been useful for testing the genetic purity or to assess the nature of differentiation of homozygote and heterozygote (Ghatage et al 2017 and Saxena et al 2014).The total of 30 primers were used for assessment of genetic fidelity of 21 genotypes. Among these 11 markers were generated resulting in 100% polymorphism nature which was higher than SSR (71.14%), SSR (41.17%) and AFLP (78.5%) in bitter gourd. The pic value ranges from -44.11 TO 0.97 respectively. These are in agreement of Saxena et al 2014 and Chiba et al 2003.Accordng to UPGMA cluster analysis the dendogram formed by NTSYS Software (2.0) i.e. based on jaccard similarity coefficient it characterize the genotype into three cluster (Fig.1). The clustering of genotypes based on marker analysis would benefit in discriminating the varieties based on their location for particular trait of interest.

The lines BRBTL and Pusa Aushadhi recorded the lowest node bearing 1^st staminate flower and were among the high yielding genotypes depicting the importance of these lines in future improvement in bitter gourd. Genotype Pallee and BRBTL had longest fruit length and highest yield. However, improvement in these characters would be achieved through selection and hybridization of given traits. The genotype Gangajalee Small had low fruit weight but highest number of fruits. High PCV along with high heritability, and genetic advance were observed for fruit weight, vitamin C, carotenoid and total phenol content, whereas high PCV along with moderate value of genetic advance was observed for days to 1^st fruit harvest, fruit length, and fruit fly infestation, number of seeds/ fruit, flavonoid, iron and fruit yield/ plant. Based on above finding breeder should adopt suitable methodology for yield improvement of bitter gourd. Assessment of a small set of genetic diversity analysis through SSR marker among 21 genotypes indicates that their potential in genetic analysis of bitter gourd for variety protection, hybrid seed purity testing and mapping.Eleven novel polymorphic microsatellite marker were isolated using a method based on simple sequence repeat for identifying repeat-motifs. The polymorphism levels of these microsatellite markers suggest their potentiality for applications in genetic diversity evaluation, molecular, DNA ﬁngerprinting, comparative genomics analysis, mapping, identification of particular trait of interest.

NN1^stSF	Node no.1st staminate flower
NN^stPF	Node no.to 1st pistillate flower
DFSFA	Days to 1st staminate flower anthesis
DFPFA	Days to 1st pistillate flower anthesis
D50%F	Days to 50% flowering
DFFH	Days to 1^st fruit harvest
VL	Vine length
ID	Internodal length
NPB/V	No of primary branches/vine
NF/Vine	No of fruits/vine
FD	Fruit diameter
FL	Fruit length
FW	Fruit weight
NS/Fruits	No of seeds/fruits
Frt Fly Infest	Fruit fly infestation
FY	Fruit yield

Ethical Approval

Not applicable

Competing interests

The authors declare no conflict of interest.

Authors' contributions

Study conception and design [Anupam Adarsh, Randhir Kumar], data collection [Anupam Adarsh, Randhir Kumar, Pankaj Kumar], analysis and interpretation of results [Pankaj Kumar Ray, Pallavi Bharti, Anjani Kumar], draft manuscript preparation [Anupam Adarsh, Pankaj Kumar, Pankaj Kumar Ray]. All authors reviewed the results and approved the final version of the manuscript.

Funding

The work was financially supported by Bihar Agricultural University, Sabour, Bhagalpur, Bihar.

Availability of data and materials

Not applicable

Acknowledgement

I would like to acknowledge my indebtedness and render my warmest thanks to my supervisor, Professor and other members of the committee. I would also wish to express my gratitude to lab of Dept of MBGE BAU, Sabour and field of Dept of Horticulture BAU Sabour.

Basch B.S., Gabardi and Ulhricht C. Bitter melon (Momordica charantiaL): A review of efficacy andsafety. Am. J. Health-System Pharm. 60:356-359. (2003).
Behera T.K., Staub J.E., Behera S., Simon W.P. Bitter gourd and human health. Medicinal and Aromatic plant science and technology. 1(2):224-226. (2007).
Cui J., Cheng J., Nong D., Peng J., Hu Y., He W., Zhou Q., DhillonN.P.S. and Hu K.Genome-Wide Analysis of Simple Sequence Repeats in Bitter Gourd (Momordica charantia).Front. Plant Sci., 8:1103: 10.3389/fpls.2017.01103. 2017.
Chiba N.,Suwabe K.,Nunome T.,Hirai M. Development of Microsatellite Markers in Melon (Cucumis melo L.) and their Application to Major Cucurbit Crops. Breeding Science. 53(1):21-27. (2003).
Dar A.A., Mahajan R.,Lay P., and Sharma S.Genetic Diversity and Population Structure of Cucumis sativus L. by using SSR markers. Biotech., 7(5): 307. (2017).
Fan Z., Robbins M.D., and Staub J.E. Population development by phenotypic selection with subsequent marker-assisted selection for line extraction in cucumber (Cucumis sativus U.). Them. AppI. Genet. 112:843-855. (2006).
Grover J.K., and Yadav S.P. Pharmacological actions and potential uses of (Momordica charantia L.) A review. J. Ethnnpharmacol., 93:123-132. (2004).
Gurbuz I., Akyuz C., Yesilada B., and Bilge S. Anti-ulcerogenic effect of (Momordica charantia L.) ruits on various ulcer models in rats. J. Ethno pharmacol. 71:77-82. (2000).
Hamissou M., Smith A.C., Carter J., Robert E. and Triplett J.K. Antioxidative properties of bitter gourd (Momordica charantia) and zucchini (Cucurbita pepo). Emi J. of Food and Agriculture. 25(9): 641- 647. (2013).
Hanchinamani C.N., Patil M.G., Dharmatti P.R. and Mokashi A.N.Studies on heritability and genetic advance in cucumber (Cucumis sativus L.). Crop Research. 41(1, 2 &3): 160-163.(2011).
Joseph John, K. Momordica sohyadrica (cucurbitaceae), an endemic species of Western Ghats of India, Nord. J. Bot., 24:539-542. (2007).
Khan A.S.M.M.R., EyasminR.M., Rashid M.H.,IshtiaqueS. andChakiA.K. Variability, heritability, character association, path analysis and morphological diversity in snake gourd. Agriculture and Natural Resources. 50(6): 483-483. (2016).
Kumar D., Kumar S., Meena R. K., Kumar M. and Vilas R.Genetic Variability, Heritability and Genetic Advance for Yield and Quality Attributes in Bitter Gourd (Momordica charantia L.). Int. J.Pure App. Biosci., 6(2): 499-503. (2018)
Maur K.L., Xia Y.M., and Bhattarai N.K. Allozyme, morphological and nutritional analysis bearing on the domestication of Momordica charantia L. (Cucurbitaceae). Leon. Bot.58:435-455. (2004).
Nath P.,Pandey A. K., Kumar A., Rai A. B. and Palanivel H. Biochemical Resistance Traits of Bitter Gourd against Fruit Fly Bactrocera cucurbitae (Coquillett) Infestation. Journal of Agricultural Science. 9(2):217-225. (2017).
Nerurkar P.V., Lee Y.K., Linden E.H., Lim S., Pearson L., Frank J., and Nerurkar V.R. Lipid lowering effects of [Momordica charantia L.] (Bitter melon) in HIV-1-protease inhibitor-treated human hepatoma cells, HepG2. Br. J. Pharmacol. 148:1156-1164. (2006).
Panday A. K., Nath, P., & Rai, A. B. Efficacy of some eco-friendly insecticides, poisons baits and their combinations against bitter gourd infestation by melon fruit fly (Bactrocera cucurbitae Coquillet). Vegetable Science, 35(2):152-155. (2008).
Panse V. G. and Sukhatme P. V. “Statistical Methods for Agricultural Workers,” 2nd Edition, Indian Council of Agricultural Research, New Delhi, (1967).
Pathak M., Manpreet and Pahwa K. Genetic variability, correlation and path coefficient analysis in bitter gourd (Momordica charantia L.). International Journal of Advanced Research. 2(8): 179-184. (2014).
Resmi J and Sreelathakumary I. Genetic variability of bitter gourd (Momordica Charantia L.) genotypes in India. Acta Scientific Agriculture. 1(1): 33-37. (2017).
Reyes M.E.,Gildemacher C.B.H., and Jansen G.J. Momordica L. pp. 206-210. In: J.S. Siemonsma and K. Piluek (eds.), Plant resources of South-East Asia: Vegetables. Pudoc Scientific Publishers, Wageningon, the Netherlands. (1994).
Saxena S., Singh A., Archak S., Behera T.K., John J.K., Meshram S.U. and Gaikwad A.B. Development of novel simple sequence repeat markers in bitter gourd (Momordica charantia L.) through enriched genomic libraries and their utilization in analysis of genetic diversity and cross-species transferability. Applied Biochemistry and Biotechnology.175 (1): 93-118. (2014).
Sidhu G.K. and Pathak M. Genetic diversity analysis in bitter gourd (Momordica charantia L.) using morphological traits. International Journal of Agriculture Innovations and Research. 5(1): 2319-1473. (2016).
Singh R.V., Verma T. S. and Thakur P. C. Characters association in cucumber. Haryana J Hort Sci. 31: 91-93. (2002).
Vujovic S., Gosbee M., Marto S., Thomson G., Chew M., and Morgan W. Bitter gourd quality description language. Melbourne, Dept. Natural Resources and Environment. (2000).
Wang S.Z., Pan L., Hu K., Chen C. and Ding Y. Development and characterization of polymorphic microsatellite markers in Momordica charantia (Cucurbitaceae). Amer J Bot.97: e75-e78. (2010).
Yadav M., Pandey T.K., Singh D.B. and Singh G.K Genetic variability, correlation coefficient and path analysis in bitter gourd. Indian Journal of Horticulture.3: 70-144. (2013).
Yang S.L., and Walters L.W. Ethnobotany and the economic role of the Cucnrbitaceae of china.Econ. Bot. 46:349-367. (1992).
Yeh G.Y., Eisenber D.M., Kaptchuk T.J., and Phillips R.S. Systematic review of herbs and dietary supplements for glycemic control in diabetes. Diabetes Care 26:1277-1294. (2003).
Yesilada E., Gurbuz I., and Shibata H. Screening of Turkish anti-ulcerogenic folk remedies for anti- Helicobocter pylori activity. J. Ethno pharmacol. 66:289-293. (1999).

Table 1:Mean of morphological traits
Genotype	NN1st SF	NN1st PF	D1st SFA	D1stPFA	D50%F	DFFH	VL (m)	IL (cm)	PB/ Vine	NF/ Vine	FD (cm)	FL (cm)	AFw (g)	NS/ Fruits	Frt Fly infest(%)	FY (g/Plant)	FY (Q/ha)
Bitter Kathi	15.41	14.87	46.48	47.60	51.72	52.35	2.94	8.17	16.23	36.75	9.29	13.73	55.26	19.45	9.13	2555.78	1022.31
Line-114	13.91	15.60	43.98	46.74	52.57	52.15	1.90	6.57	14.45	31.43	7.65	10.03	43.05	22.83	12.17	1707.08	682.83
Line-214	12.55	15.40	43.40	44.86	51.09	51.99	2.33	8.37	14.77	38.75	7.75	12.71	53.64	22.52	14.15	2392.70	957.08
Line-314	15.23	14.31	42.43	46.58	49.20	52.05	1.71	8.17	13.17	22.77	7.17	12.26	57.38	32.17	15.37	1702.44	680.98
BRBTL	13.15	13.21	44.68	41.35	52.72	50.78	2.61	4.75	13.65	38.28	14.50	19.42	144.45	22.53	16.89	3761.25	1504.50
Line-514	14.83	15.73	42.45	45.18	50.14	54.47	1.92	7.92	12.65	33.09	8.23	17.46	58.31	30.13	15.79	2425.16	970.06
Line-814	10.73	14.19	44.82	46.55	50.00	56.82	1.85	7.57	13.13	37.46	7.65	12.34	67.89	32.84	8.49	3195.38	1278.15
Meghdoot	13.60	15.29	51.99	47.30	47.98	58.53	2.03	8.09	13.43	33.84	7.85	12.02	56.81	26.02	14.29	2418.31	967.32
Preethi	15.46	16.08	47.58	47.55	54.17	55.44	1.41	8.21	13.89	40.59	7.67	14.56	62.41	40.16	15.36	3218.74	1287.50
Gangajalee Small	16.24	14.76	46.38	49.87	52.16	55.49	2.32	7.39	13.94	36.55	7.35	7.46	33.35	17.49	9.29	1639.29	655.71
Jhalari	14.64	15.58	47.47	43.93	51.71	52.47	2.14	7.61	13.65	37.77	8.75	19.14	44.99	38.23	8.92	2090.20	836.08
Indira	13.44	13.55	49.18	46.89	50.94	51.36	1.95	8.25	13.29	35.66	6.83	16.02	60.18	37.53	15.19	2559.32	1023.73
Pusa Aushadhi	10.21	9.41	41.12	40.20	38.12	48.28	2.71	7.19	13.95	35.75	8.31	16.42	61.49	27.27	17.53	2830.98	1132.39
Pirpaiti Local	14.32	13.08	48.77	48.29	51.25	53.88	2.13	7.37	13.73	32.35	7.82	13.32	41.86	24.00	13.34	1611.24	644.50
Konkan Tara	15.02	14.95	46.79	48.28	54.02	54.02	1.89	5.17	12.16	41.46	8.45	7.12	27.98	28.10	9.79	1891.85	756.74
Pusa Rasdar	14.56	14.36	47.29	44.74	51.09	51.41	1.32	5.71	13.39	31.08	9.46	14.44	50.27	25.63	16.42	1959.11	783.65
BRBTW	15.13	16.16	48.03	50.52	51.65	59.63	2.05	5.59	13.07	34.70	7.83	16.33	52.80	30.04	13.70	2269.68	907.87
Swarnayamini	15.91	15.25	46.84	46.76	50.92	61.28	1.99	6.69	14.15	35.65	7.97	19.02	57.80	28.03	15.93	2588.51	1035.41
BRBTG	14.40	15.49	47.57	46.12	52.81	53.67	2.38	6.17	12.69	36.99	7.92	19.42	46.86	25.71	16.46	2648.10	1059.24
Leena	14.90	15.29	48.81	49.83	50.76	53.86	2.49	7.56	12.45	35.13	12.27	19.74	56.10	24.73	17.04	2481.88	992.75
Pallee	15.00	14.89	48.38	46.75	51.84	52.23	2.33	7.31	13.09	31.79	12.30	20.24	61.84	32.05	16.14	2517.79	1007.12
Mean	14.22	14.64	46.40	46.47	50.80	53.91	2.11	7.13	13.56	35.14	8.72	14.91	56.89	5.07	6.05	2403.09	961.23
C.V.	8.08	8.18	4.12	4.11	4.21	2.17	7.85	5.17	6.02	5.06	6.13	5.03	5.03	5.07	6.05	10.02	10.02
S.E.	0.66	0.69	1.10	1.10	1.23	0.68	0.10	0.21	0.47	1.03	0.31	0.43	1.65	0.67	0.40	139.01	55.60
C.D. 5%	1.90	1.98	3.16	3.15	3.53	1.93	0.27	0.61	1.35	2.93	0.88	1.24	4.72	1.40	0.83	397.32	158.93
C.D. 1%	2.54	2.64	4.23	4.21	4.72	2.58	0.37	0.81	1.80	3.92	1.18	1.66	6.32	2.68	1.54	531.66	212.66
Range Lowest	10.21	9.41	41.12	40.20	38.12	48.28	1.32	4.75	12.16	22.77	6.83	7.12	27.98	17.49	8.49	1611.24	644.50
Range Highest	16.24	16.16	51.99	50.52	54.17	61.28	2.94	8.37	16.23	41.46	14.50	20.24	144.45	40.16	17.53	3761.25	1504.50

Contd…

Genotype/ Character	Ascorbic acid (mg/100g)	Titrable Acidity (%)	Total carotenoid (mg/100 g)	Total Chlorophyll (%)	Total Sugar (g/ 100 g)	Total Phenol (mg CE/ 100 g FW)	Flavonoids (mg/g)	Iron (mg/100g)
Bitter Kathi	84.00	0.31	0.35	0.95	0.22	3.55	21.68	0.30
Line-114	43.03	0.65	0.22	0.90	0.37	5.65	19.75	0.36
Line-214	77.23	0.96	0.68	0.54	0.29	2.06	11.97	0.29
Line-314	51.68	0.23	0.36	1.09	0.32	2.48	22.61	0.42
BRBTL	463.75	0.42	0.86	0.83	0.48	7.75	16.64	0.46
Line-514	80.89	1.25	0.37	1.20	0.27	1.68	22.65	0.27
Line-814	54.58	0.64	0.46	1.40	0.39	6.16	10.76	0.38
Meghdoot	61.80	0.98	0.15	1.44	0.30	2.24	20.55	0.64
Preethi	46.83	0.94	0.80	1.63	0.26	1.56	12.52	0.46
G. Small	337.07	0.65	1.37	0.45	0.96	5.56	13.89	0.32
Jhalari	59.53	0.98	0.74	0.75	0.35	1.31	17.31	0.36
Indira	62.67	0.78	0.80	0.83	0.28	2.16	15.39	0.78
Pusa Aushadhi	46.27	1.13	1.24	0.60	0.31	6.57	13.51	0.64
Pirpaiti Local	50.47	0.23	0.64	0.65	0.22	4.35	8.67	0.26
Konkan Tara	640.21	2.12	1.86	1.33	0.42	5.17	21.46	0.78
Pusa Rasdar	77.67	0.32	1.15	1.59	0.42	5.26	14.63	0.56
BRBTW-1	65.53	0.44	0.65	1.13	0.34	9.17	9.13	0.92
Swarnayamini	51.94	0.36	0.91	0.50	0.36	3.07	22.73	0.48
BRBTG	76.75	0.56	0.94	0.65	0.30	4.55	17.46	0.52
Leena	76.63	0.24	0.86	1.17	0.35	4.97	17.42	0.49
Pallee	76.00	0.34	0.96	1.55	0.40	4.11	17.56	0.59
Mean	123.07	0.69	0.78	1.01	0.36	4.26	16.59	0.49
C.V.	1.15	1.78	0.02	6.07	7.16	2.62	1.15	7.23
S.E.	84.00	0.31	0.35	0.04	0.01	0.06	0.11	0.02
C.D. 5%	43.03	0.65	0.22	0.10	0.04	0.18	0.31	0.06
C.D. 1%	77.23	0.96	0.68	0.14	0.06	0.25	0.42	0.08
Range Lowest	51.68	0.23	0.22	0.45	0.22	1.31	8.67	0.26
Range Highest	463.75	0.42	1.86	1.63	0.96	9.17	22.73	0.92

Table 2:Genotypic coefficient of variation ,Phenotypic coefficient of variation, Heritability, Genetic Advance, Genetic Advance as % of mean for various traits of bitter gourd
S.No.	Characters	Genotypic coefficient of variation	Phenotypic coefficient of variation	Heritability	Genetic Advance	Genetic Advance as % of mean
1.	Node no.1st staminate flower	10.38	11.70	78.58	2.69	18.93
2.	Node no.to 1st pistillate flower	9.45	11.22	70.89	2.40	16.39
3.	Days to 1st staminate flower anthesis	5.22	6.65	61.59	3.91	8.44
4.	Days to 1st pistillate flower anthesis	4.92	6.41	58.97	3.62	7.79
5.	Days to 50% flowering	5.91	7.25	66.37	5.04	9.92
6.	Fruit diameter(cm)	64.07	66.51	92.82	3.82	43.77
7.	VL(m)	18.27	19.89	84.41	0.71	34.58
8.	Fruit weight(gm)	39.20	39.52	98.38	45.56	80.09
9.	ID(cm)	14.99	15.86	89.71	2.08	29.19
10.	No of fruits/vine	11.04	12.15	82.66	7.27	20.68
11.	NPB/V	5.56	8.20	46.20	1.06	7.81
12.	DFFH	5.63	6.04	87.10	5.84	10.84
13.	Fruit length(cm)	130.50	132.88	96.46	7.92	53.11
14.	Fruit Fly Infestation	21.67	21.86	94.62	11.92	42.62
15.	No of seeds/fruit	21.47	22.30	92.65	5.31	42.57
16.	Vitamin c	127.99	127.99	100.01	324.47	263.65
17.	Acidity	66.04	66.07	99.92	0.94	135.98
18.	Total Carotenoid(µg/g)	52.57	52.59	99.92	108.24	842.52
19.	Total Chlorophyll(fruit)	37.63	37.72	99.53	0.78	77.33
20.	Total Sugar	42.32	42.71	98.16	0.31	86.37
21.	Total Phenols(mg/g)	50.47	50.56	99.73	4.42	103.82
22.	Flavonoids(mg/g)	27.00	27.02	99.86	9.22	55.58
23.	Iron(µg/g)	37.61	37.61	99.69	0.38	77.37
24.	Fruit yield(g/plant)	22.52	24.65	83.48	1018.47	42.38

Table3. Polymorphism % of bitter gourd genotypes
S. No.	Primer	Sequences		Total no. of amplified fragments	Monomorphic bands	Polymorphic bands	Polymorphism (%)	Total/ genotype	(Total/genotype)²	PIC
	(Operon code)	Left	Right	Total no. of amplified fragments	Monomorphic bands	Polymorphic bands	Polymorphism (%)	Total/ genotype	(Total/genotype)²	PIC
1	(GA)5	GACAAAAACAACAACCAGAGGC	CTCCTCCTTCTTCTCTCCTGCG	1		1	100	0.71	0.51	0.74
2	(GA)4(GAA)5GGAGA(GAA)4	AGGGGAATAACAGAGAGGTGG	TGCTAATTTGCCTCTCGTCG	1		1	100	0.71	0.51	0.74
3	(AT)12	TCCCGCTTCCTCACATCTGC	GGGGTTGAAACACGAGAGTGC	1		1	100	0.86	0.73	0.46
4	(CTT)3GA(TCT)4(TTTTC)(TCTT)2	CTTTAACTCACCTTCCACACCC	ACGATATGATCGAATGTCCACC	1		1	100	1.00	1.00	0.00
5	(AAG)3	CAATTGAGCCACCTTTTGGG	TAGCATCGATCCATGGCTCC	1		1	100	0.95	0.91	0.97
6	(AAG)5	GAATAGCTTTCGTCGCCTGC	CGGATATCTCCGCTTCTCTCC	2	1	1	50	1.67	2.78	-44.11
7	(GGTTC)3	CCATGACCGATGTAGCACTCC	TCGAACCAACCTAAACCAG	1	1	1	50	0.95	0.91	0.97
8	(TCTCGA)2	ATTTCCATTTCGCGATTCAG	GCCTTGTTTTCCGAAAGAGAT	1		1	100	0.95	0.91	0.97
9	(TC)4	ATCCAACCAATAACCGGAAG	CTACCATTTTGGGGACGAGA	1		1	100	0.90	0.82	0.89
10	(CT)4	TGCCATACTCCCAGGAAAAG	CGGAGACCTGTGTTTTTGGT	2		2	200	1.43	2.04	-9.02
11	(GT)13	GCCAAGGGAAATTGTAATACG	AAACAACGTTGATGGCAAGA	1		1	100	1.00	1.00	0.00

No competing interests reported.

Genetic diversity of indigenous bitter gourd (Momordica charantia L.) genotypes by morphological and molecular marker

Status:

Version 1

Abstract

Figures

Introduction

Material And Methods

Results

Discussion

Conclusions

Abbreviations

Declarations

References

Tables

Additional Declarations

Status:

Version 1