Specimen collection, tissue microarray and immunohistochemical staining
15 cases of histologically confirmed tumors and matched adjacent non-tumor tissues came from HCC patients who underwent radical hepatectomy at Lanzhou University First Hospital. The study was approved by the hospital ethics committee and according to the institutional review committee's procedures, all patients had signed an informed consent form before the study. Purchased a tissue microarray containing 90 tumor tissues and matched adjacent non-tumor tissues from Shanghai Outdo Biotech Co., LTD (Shanghai, China).
All patients obtained written informed consent and were followed up for 5–6 years with clear prognostic information.
Perform immunohistochemical staining as previously described[
24]. For immunohistochemical images, two experienced pathologists independently performed immunohistochemical staining scores according to the staining intensity (0: absence; 1: weak staining; 2: moderate staining; 3: strong staining) and the proportion of positive cells (0: negative; 1: < 25%%; 2: 26–50%; 3: > 50%). The staining intensity score plus the staining proportion score to calculate the final immunohistochemistry score. We defined immunohistochemical score 0 to 4 as low expression, and 5 to 6 as high expression.
Cell culture
Human liver cancer cell lines HepG2, Huh7 and HCCLM3 were purchased from China Center for Type Culture Collection (CCTCC, Wuhan, China) and were identified for short tandem repeats (STR). L02 hepatocytes were giftted from Zhongshan Hospital of Fudan University (Shanghai, China). Embryonic kidney cell line HEK-293T was a gift from Shanghai Genechem Co., Ltd. (Shanghai, China). All cells are grown in Dulbecco’s modified Eagle’s medium (DMEM, pH = 7.2, Gibco Company, Grand Island, NY, USA) containing 10% (v/v) fetal bovine serum (FBS, Hyclone, Logan, UT, USA). All cells were cultured in a humidified incubator (Thermo Fisher Scientific, Waltham, MA, USA) at 37 ℃ and 5% CO2. All cells were tested for mycoplasma contamination.
RNA isolation
Harvested total RNA from cells and tissues using RNAiso Plus (Takara Holdings Inc., Kyoto, Japan) and follow the recommended manufacturer protocol to isolate total RNA. NanoDrop 2000 (Thermo Fisher Scientific, Waltham, MA, USA) was used to measure the quality and quantity of isolated RNA.
3′and 5′adaptor ligation, complementary DNA (cDNA) first strand synthesis and real time PCR
Heavy modifications contain in tRNA, such as 3′-aminoacyl, 3′-cP, m1A, m1G, and m3C methylations will seriously interfere with the reverse transcription. Therefore, conventional PCR methods may not be able to reflect the true expression of tRNA-derived fragments[25]. This work used rtStar™ tRF&tiRNA Pretreatment Kit (Arraystar Inc., Rockville, MD, USA. Cat #AS-FS-005) to remove various modifications of Gly-tRF before 3′and 5′adaptor ligation and cDNA synthesis. Synthesize cDNA using APExBIO first-strand cDNA synsthesis supermix (APExBIO Inc., Houston, TX, USA. Cat #K1073). All steps such as 3′-terminal deacylation, 3′-cP removal and 5′-P addition, demethylation and reverse transcription are carried out in accordance with the manufacturer's instructions. All reactions were performed on the Mx3000P QPCR system (Agilent Technologies Inc., Santa Clara, CA, USA) using the TB Green Premix Ex Taq II (Takara Holdings Inc., Kyoto, Japan) for real-time PCR according to the manufacturer's instructions. The primers are shown in Table 1. U6 or GAPDH expression for normalized endogenous control. The relative expression levels of Gly-tRF were analyzed by 2−ΔΔCT method.
Table 1
Sequences information in this study
Genes | Sequences |
---|
Gly-tRF | GCAUUGGUGGUUCAGUGGUAGAAUUCUCGC |
Forward: CATTGGTGGTTCAGTGGTAGAAT Reverse: AGTGCAGGGTCCGAGGTATT |
Gly-tRF NC-inhibitor | TTCTCCGAACGTGTCACGT |
Gly-tRF inhibitor | GCGAGAATTCTACCACTGAACCACCAATGC |
Gly-tRF NC-mimic | CON238 |
Gly-tRF mimic | GCCTTGTTAAGTGCTCGCTTCGGCAGCACATATACTATGTTTGAATGAGGCTTCAGTACTTTACAGAATCGTTGCCTGCACATCTTGGAAACACTTGCTGGGATTACTTCTTCAGGTTAACCCAACAGAAGGCTCGAGAAGGTATATTGCTGTTGACAGTGAGCGACGAGAATTCTACCACTGAACCACCAATGCTAGTGAAGCCACAGATGTAGCATTGGTGGTTCAGTGGTAGAATTCTCGCTGCCTACTGCCTCGCAATTCAAGGGGCTACTTTAGGAGCAATTATCTTGTTTACTAAAACTGAATACCTTGCTATCTCTTTGATACATTTTTACAAAGCTGAATTAAAATGGTATAAATTAAATCACTTTTTTCAATTGGAAGACTAATGCGTTTAAACACGCGGCG |
NDFIP2 | Forward: TCAAACCCAGCACCGCAGATTG Reverse: CGCAGATAGCACCATACCTTCCAG |
ABHD17B | Forward: GCTGCTTGGCTTGCTCTTAGGAC Reverse: TTCAACCCAGAGAGGCTCCACAG |
KCNK10 | Forward: ATGAAGTGGAAGACGGTGGTTGC Reverse: AGTGGCTGCTGTTGTTGGAAGAG |
RNF103 | Forward: TCATGGGTAAGGGCAGACTGGATG Reverse: AAAGAAGCAATCGGGTGGAAGAGG |
CXXC4 | Forward: TCCTCCTCCGCCTCCTCCTC Reverse: TGGCAATTTGAAACGCACTGTCTG |
OXTR | Forward: GGTGGTGGCAGTGTTTCAGGTG Reverse: CAGGCAGCGAGCACGATGAC |
WDR44 | Forward: CAGTGGAAGTCAAAGGAGGTGGTG Reverse: GCCATGCTTGCGGTTAGGAGAG |
OSER1 | Forward: AGCACCAGTCAGAACAGCAACAG Reverse: TTGGGTAGCGTCAGAGGAGTCTTC |
GAPDH | Forward: CCCACTAACATCAAATGGGG Reverse: CCTTCCACAATGCCAAAGTT |
U6 | Forward: CGCTTCGGCAGCACATATAC Reverse: GAACGCTTCACGAATTTGCGT |
Table 2
Target genes of Gly-tRF predicted by miRDB
Gene | Gene description | Predicted target score | 3´UTR length | Seed position |
---|
ABHD17B | Abhydrolase domain containing 17B | 96 | 129 | 82 |
NDFIP2 | Nedd4 family interacting protein 2 | 96 | 3564 | 32 |
KCNK10 | Potassium two pore domain channel Subfamily K member 10 | 95 | 5427 | 676 |
RNF103 | Ring finger protein 103 | 95 | 1564 | 896 |
CXXC4 OXTR | CXXC finger protein 4 Oxytocin receptor | 95 95 | 4106 2569 | 2120,2783 1560, 2131, 2537 |
WDR44 | WD repeat domain 44 | 94 | 974 | 860 |
OSER1 | Oxidative stress responsive serine rich 1 | 94 | 1113 | 29 |
Cell transfection
HCCLM3 and HuH7 cells were seeded in 6-well plates (Corning Life Sciences, USA) at a density of 4×105 per well, when the cell fusion rate reached 40–50%, Gly-tRF negative control, Gly-tRF inhibitor, Gly-tRF mimic lentivirus were used transfected cells according to the manufacturer's instructions (Shanghai Genechem Co., Ltd. Shanghai, China). The sequences of all lentivirus products are shown in Table 1. After 72 h of transfection, the cells were cultured in complete medium containing 2ug/µL puromycin for 72 h. Gly-tRF stably transfected cells were used for subsequent experiments.
Proportion analysis of representative markers of liver cancer stem cells
HCC cells are prepared as a single cell suspension for staining. All antibodies used for staining were purchased from Miltenyi Biotec (Bergisch Gladbac, Germany), including phycoerythrin (PE)-conjugated CD133 antibody (Cat #130-110-962), PE-Vio770-conjugated CD13 antibody (Cat #130-120-727), allophycocyanin (APC)-conjugated EpCAM antibody (Cat #130-111-000), APC-Vio770-conjugated CD44 antibody (Cat #130-113-339) and REA control antibody (Cat # 130-113-438, 130-113-440, 130-113-434, 130-113-445, respectively). Detected the percentage of CD133, CD13, EpCAM, CD44 in the HCC cells population according to the manufacturer’s instructions. In brief, 1×106 cells were centrifuged and resuspended in 98ul buffer, added 2µL antibody and incubated for 10min in the dark at 4℃. Washed with 1ml buffer, centrifuged at 300g for 10min, and resuspend in 400ul buffer for detection. Data was acquired by BD LSRFortessa. All samples were carried out in triplicate.
Sphere formation assays
2000 cells/well were planted on an ultra-low adhesion 6-well plate (Corning, USA), after 8-day incubation, spheres were counted and photographed (random 15 fields/well) on a stereo microscope (Olympus, Tokyo, Japan). The diameter of the spheres was measured by Image Pro Plus 6.0 software (Media Cybernetics Inc., Rockville, MD, USA), those clones with a diameter greater than 20µm were considered positive for spheres formation.
Transwell assays
Cell migration experiments were performed in a 24-well transwell chamber (0.8um pore size, Corning Life Sciences, Costar, USA). Stably transfected cells starved for 6 h in serum-free medium, trypsinized the cells and adjusted the cell concentration to 2×105 cells / mL after counting. 600 µL of complete medium containing 30% (v/v) serum was added to the lower chamber, 200 µL of cell suspension was added to the upper chamber, and cultured for 48 h. The cells in the upper chamber were taken and fixed with 4% paraformaldehyde (Solarbio, Beijing, China). After 0.5% crystal violet (Solarbio, Beijing, China) staining, they were observed under a microscope and photographed. All experiments were repeated three times.
Scratched wound assays
Trypsinized the stable transfected cells and seeded on a 6-well plate. When the cells fusion rate reached 90%, a 200 µL sterile pipette tip was used to uniformly make vertical intersection scratches in the 6-well plate. Washed off the cells 3 times with 1X PBS, and selected multiple random fields to observe the cell migration at 0h, 24h, 48h. Quantify the area and width of the scratches with Image-Pro Plus 6.0.
Protein extraction and western blotting analysis
The cells were washed with PBS, lysed with radio-immunoprecipitation assay (RIPA) lysis buffer (Beyotime, Shanghai, China) containing 1% 10 µM Phenylmethanesulfonyl fluoride (PMSF) and 1% phosphatase inhibitor. Quantitative protein concentration using bicinchoninic acid kit (BCA, Vazyme Biotechnology Co., Ltd., Nanjing, China). After protein reduction and denaturation, the equal amount of protein lysis and Page Ruler prestained protein ladder were loaded into 10% SDS-PAGE gel, then transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, Billerica, MA, USA). The membranes were blocked with 5 % bovine serum albumin (BSA) and incubated (overnight, 4°C) with primary antibodies. Western blot was performed using antibodies that anti-NDFIP2(1:1000, Bioss antibodies Inc., Beijing, China. Cat # bs-19059R), anti-pan AKT (1:1000, Abcam, Cambridge, UK, Cat # ab8805), anti-AKT1 phospho (1:1000, Abcam, Cat # ab66138), anti-N cadherin (1:1000, Abcam, Cat # ab18203), anti-E cadherin (1:10000, Abcam, Cat # ab40772). After washings with TBS-T, membranes were incubated with the secondary antibody for 1 hour at room temperature. Protein bands are visualized with Western chemiluminescent HRP substrate (Millipore, Billerica, MA, USA). Anti-β-actin antibody (1:2000, Sigma, USA) is used as an internal control to ensure the equal amount of protein loading.
Immunofluorescence staining
Stably transfected cells grow overnight on glass coverslips. The cells were fixed with 4% paraformaldehyde for 10 minutes at room temperature. Wash the cells 3 times with ice PBS. Incubate the cells with PBS (containing 0.3% Triton X-100) for 10 minutes. Wash the cells 3 times with PBS for 5 minutes each. Block cells with 3% BSA for 30 minutes at room temperature. Incubate cells with anti-NDFIP2 antibody (1:200, Bioss antibodies Inc., Beijing, China. Cat # bs-19059R) overnight at 4°C. Wash the cells 3 times with PBS-T, Then the cells were incubated with Cy5 conjugated Goat Anti-Rabbit IgG (1:400, Servicebio, Wuhan, China, GB27303) at room temperature in the dark for 60 minutes. 4′, 6-Diamidino-2-phenylindole (DAPI, Servicebio) incubate the cells for 5 minutes. After washing with PBS, images were captured using a fluorescence microscope (Nikon Eclipse C1; Nikon Corporation). Fluorescence quantitative analysis using Image-Pro Plus 6.0.
Plasmid construction, transfection and luciferase assay
NDFIP2 overexpression plasmid (pcDNA3.1 + NDFIP2 OE), NDFIP2 3′ UTR wild-type (NDFIP2 wt) and NDFIP2 3′ UTR mutant-type (NDFIP2 mut) luciferase reporter plasmids were all constructed from TSINGKE (Beijing, China). Renilla luciferase reporter plasmid pRL-TK and pGL6 promoter empty vector (pGL6, Beyotime, Shanghai, China), NDFIP2 wt or NDFIP2 mut co-transfected into HEK-293T cells in each well using Exfect Transfection Reagent (Vazyme Biotechnology Co., Ltd., Nanjing, China) followed the manufacturer's instructions. In short, 50ng pRL-TK plasmid and 400ng NDFIP2 wt, NDFIP2 mut or pGL6 were added to Opti-MEM, then mixed with 1 µL liposome and incubated for 10 minutes at room temperature. 48 hours after transfection, the cells were lysed, followed the dual-luciferase® report analysis system (Promega, Madison, WI, USA) to perform dual-reporter assays. GLOMAX 20/20 LUMINOMETER (Promega, Madison, WI, USA) was used to detect luciferase activity. All samples were carried out in triplicate. The same method was performed to transfect HCCLM3 cells using pcDNA3.1 + NDFIP2 OE and pcDNA3.1 empty plasmid (pcDNA3.1 + vector). In short, 3 µg pcDNA3.1 + NDFIP2 OE or pcDNA3.1 + vector and 9 µL liposomes were added to the cells. After 48 h of cultivation, follow-up experiments were performed.
Bioinformatics analysis
Download gene expression profiles and clinical data based on the TCGA XENA database(https://xena.ucsc.edu/) for screening differentially expressed genes (DEGs) between HCC tissues and matched non-tumor tissues. Performed Gene Ontology (GO) for DEGs.
Statistical analysis
GraphPad Prism 8 (La Jolla, CA, USA) was used for all statistical analyses and drafts. P < 0.05 was considered statistically significant. A Student’s t-test or one-way ANOVA were used for groups comparisons of quantitative data.