Reagents
Psoralen (purity >98%) was supplied by Yuanye Biotechnology Co., Ltd. (Shanghai, China). D-glucose was obtained from from Sigma-Aldrich (St. Louis, MO, USA). Antibodies of Bax, active caspase 3, active caspase 9, Apf1, β-actin and α-SMA, anti-collagen III, TLR4, p-p65, p65, p-IκBα, IκBα, p-Smad2, Smad2, Vimentin, and E-cadherin were provided by Abcam (Cambridge, MA, USA). All secondary antibodies used in this study were purchased from Abcam (Cambridge, MA, USA).
Cell culture
HK-2 cells were obtained from American Type Culture Collection (ATCC, Rockville, MD, USA). The cells were cultured in DMEM/F12 (GIBCO, Grand Island, NY, USA) media supplemented with FBS (10%, GIBCO, Grand Island, NY, USA), streptomycin (100 mg/mL) and penicillin (100 U/mL). The cells were maintained in humidified incubators with 5% CO2 at 37°C.
Cell viability assay
Cell counting kit-8 (CCK-8, Beyotime Biotech, Shanghai, China) was used to determine cell viability. After seeding into 96-well plates (4000/well) and cultured overnight, specific treatment for each group was applied. After further culture of 48h,10 µL of CCK-8 solution was added to cells to measure cell viability. The absorbance at 450 nm was measured with a microplate reader (Bio-Rad Laboratories, Richmond, CA, USA) at 2 h after co-culture with CCK-8 solution,.
Cell transfection
The cells were seeded into 6-well culture plates at density of 120,000/well. All transfections were performed using Lipofectamine 2000 reagent (Invitrogen; Thermo Fisher Scientific) according to the manufacturer’s protocol. After 48 h of incubation, the cells were subjected to quantitative real‐time PCR.
Quantitative real‐time PCR (RT-qPCR)
Total RNAs were extracted from cells using TRIZOL reagent (Invitrogen, CA, USA). PrimeScript 1st strand cDNA synthesis kit (Takara Bio Inc., Kyoto, Japan) was applied for reverse transcription into cDNA. Quantitative RT-PCR was performed on 7900HT Fast Real-Time PCR system (Applied Biosystems, NY, USA) and conducted with miScript SYBR Green PCR Kit (Qiagen, Duesseldorf, Germany). The relative quantitation of mRNA expression was measured by 2-ΔΔ Ctmethod. Sequences of primers were as followed: miR‑214 forward, 5'‑AGCATAATACAG CAGGCACAGAC‑3' and reverse, 5'‑AAA GGTTGTTCTCCA CTCTCT CAC‑3'; miR-379-5p forward, 5′-GCGCTGGTAGACTATGGAA-3′ and reverse, 5′-GTG CAGGGTCCGAGGT-3′; miR-874 forward, 5'- GGCCCTGAGGAAGAACTGAG‑3' and reverse, 5'‑TGAG ATCCAACAGGCCTTGAC‑3'; miR-770-5p forward, 5’-CCAGTACCACGTGTCAG-3’ and reverse, 5’-GAACATGTCTGCGTATCTC-3’; miR-22 forward, 5′-TGCGCAGTTCTTCAGTGGCAAG-3′ and reverse, 5′-CCAGTGCAGGGTCCGAGGTATT-3′; U6 forward, 5'‑ATTGGAACGATACAGAGAAGATT‑3' and reverse, 5'‑GGAACGCTTCACGAATTTG‑3'.
Immunofluorescence
The cell proliferation was evaluated by Ki67 immunofluorescence assay [21]. After being fixed with 4% formaldehyde for 10 min, HK-2 cells were permeabilized with 0.3% Triton X-100 (Sigma-Aldrich, St. Louis, MO, USA) for 15 min at room temperature. Cells were then incubated with primary antibody against Ki67 (Abcam, Cambridge, MA, USA) overnight at 4°C. The next day, the cells were washed with PBS for three times and then incubated with goat anti-rabbit secondary antibody (Abcam, Cambridge, MA, USA) at 37°C for 1 h. Following incubating with secondary antibody, cells were stained with DAPI (Abcam, Cambridge, MA, USA) for 5 min. After the final washing step with PBS, images were captured using a laser scanning confocal microscope (Leica, Buffalo Grove, IL, USA).
Flow cytometry assay
The cells from all groups were digested, resuspended, and washed twice with PBS. 1x105 cells from each group was collected and subjected to Annexin V/PI staining (Beyotime Bioch, Shanghai, China). Cell apoptosis were observed and analyzed using FACSAria flow cytometry (BD Biosciences, San Jose, CA, USA).
Western blot
Protein samples are isolated from cells using mammalian protein extraction buffer (GE Healthcare, Milwaukee, WI, USA) supplemented with complete protease inhibitor cocktail (Roche Diagnostics, Mannheim, Germany). Equal amounts of total proteins (20 μg) were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto nitrocellulose membranes (EMD, Millipore, Billerica, MA, USA). Followed by blocking with 5% skimmed milk for 30 min at room temperature, the membranes were incubated with specific primary antibodies at 4°C overnight. Subsequently the membranes were incubated with horseradish peroxidase-conjugated secondary antibodies for 1 h at room temperature. Immobilon Western Chemiluminescent HRP Substrate (Millipore, St. Charles, MO, USA) was used to visualize protein bands. Protein signals were quantified with ImageJ (Version1.8.0, National Institutes of Health, Bethesda, Maryland, USA) .
ELISA (enzyme linked immunosorbent assay)
The cells in each group was collected and centrifuged at 3200g for 20 min at 4°C. ELISA kits (Nanjing Jiancheng Bio Institute, Nanjing, China) were used to measure the secretion of inflammatory cytokines in the cell culture supernatant according to the manufacturer’s protocols. The detected cytokines included IL-6, IL-18, IL-1b, TNF-a and IL-10. Briefly, supernatants from all groups were incubated with 100 µM of enzyme-specific substrates at 37°C for 4 h. The absorbance at 450 nm was read with MTP-32 microplate reader (Corona Electric Co., Ltd., Ibaraki, Japan).
Statistical analysis
The experiment was repeated in triplicate. All the data are presented as the mean ± SD. The comparisons among groups were conducted with one-way analysis of variance (ANOVA) followed by Tukey’s test. P<0.05 was considered statistically significant. GraphPad Prism 7.0 (La Jolla, CA, USA) was used for statistical analysis.