Experimental subjects
All animal experiments were approved by the Committee on the Ethics of Animal Experiments of the National Institute of Neuroscience, National Center of Neurology and Psychiatry (2021012). C57BL/6J mice were obtained from Tokyo Laboratory Animal Science and Japan SLC. The mice were housed in groups of three in an air-conditioned room at 23 ± 1°C, with a 12-h light–dark cycle under specific pathogen-free conditions. All mice had free access to water and food. The mice were randomly assigned to groups.
Primary culture of cortical neurons
Primary cultures of cortical neurons were prepared from the mice on postnatal day 1 [11]. The cerebral cortices were dissected and dissociated with 0.25% trypsin in phosphate buffer saline (PBS) at 37°C for 15 min. After neutralization with fetal bovine serum (Sigma-Aldrich, St Louis, MO, USA), the cells were centrifuged at 400 × g for 3 min and suspended in 10% fetal bovine serum-Dulbecco’s modified Eagle’s medium (Thermo Fisher Scientific, Waltham, MA, USA). Cell suspensions were filtered through a 70 μm nylon cell strainer, and cells were plated on poly-L-lysine (Sigma-Aldrich)-precoated 48-well dishes at a density of 1 × 105 cells/well. Cells were maintained at 37°C and 5% CO2.
One day after plating, mouse siGENOME siRNAs (Horizon Discovery, Waterbeach, GB) for the target genes (Fig. 1A, Table 1) were transfected into cultured cortical neurons using Lipofectamine® 2000 (Thermo Fisher Scientific). To measure neurite length, the transfected cells were cultured for an additional 3 days and then re-plated and grown for another 1 day in 10% fetal bovine serum-Dulbecco’s modified Eagle’s medium.
Immunocytochemistry
Cultured cortical neurons were fixed with 4% paraformaldehyde in PBS for 30 min and permeabilized using 0.1% Triton-X-100 in PBS for 10 min at 20–25°C. The samples were treated with blocking buffer (PBS containing 3% normal donkey serum) for 1 h at 20–25°C, followed by incubation with rabbit anti-class III beta-tubulin antibody (Tuj1, 1:2000, Cat# 802001, BioLegend, San Diego, CA, USA) diluted in blocking buffer overnight at 4°C. The cells were then treated with the secondary antibody, Alexa Fluor 488-conjugated donkey antibody against rabbit IgG (Thermo Fisher Scientific), diluted in blocking buffer for 1 h at 20–25°C. The nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI, 1 mg/ml, Dojindo Laboratories, Kumamoto, Japan). Images were acquired using an IN Cell Analyzer 2000 (GE Healthcare, Chicago, IL, USA) 20 × objective lens, and neurite length was measured using ImageJ software.
Quantitative RT-PCR
To evaluate the knockdown efficiency, transfected cells were cultured for an additional 3 days and used for real-time PCR analysis. Total RNA was isolated from cultured cortical neurons using an RNeasy Mini Kit (Qiagen, Hilden, Germany). cDNA was synthesized using a High-Capacity cDNA Reverse Transcriptase Kit (Applied Biosystems, Waltham, MA, USA). Real-time RT-PCR was performed using KAPA SYBR Fast Master Mix (KAPA Biosystems, Wilmington, MA, USA) with the following primer pairs: Syt4 forward, GACAGAGCACGCAGAAAACA; Syt4 reverse, AGTGAAGACGAGGCCAAAAG; GAPDH forward, AGGTCGGTGTGAACGGATTTG; and GAPDH reverse, TGTAGACCATGTAGTTGAGGTCA. PCR conditions included one cycle at 95°C for 30 s, followed by 39 cycles at 95°C for 5 s and 60°C for 45 s. Melting analysis was performed using PCR to monitor amplification specificity. Relative mRNA expression was normalized to GAPDH mRNA levels in the same samples and calculated using the ∆/∆-Ct method.
RNA-seq
To evaluate the effect of Syt4 on mRNA expression in cortical neurons, total RNA was extracted from cortical neuron cultures 3 days after Syt4 siRNA transfection using the RNeasy Mini Kit (Qiagen). Strand-specific RNA-seq libraries were prepared from depleted RNA using a TruSeq Stranded mRNA Sample Prep Kit (Illumina, San Diego, CA, USA) and sequenced on an Illumina HiSeq 2500 device (HiSeq 2500 System User Guide Part #15011190 Rev. V HCS 2.2.70 protocol. 2.9.) in the 75-base single end mode. Base calling was performed using Illumina Casava ver.1.8.2 software. Sequenced reads were mapped to mouse reference genome sequences (mm10) using Hisat2 ver. 2.1.0, SAMtools ver. 1.9., and Stringtie ver. 2.0. The RNA-seq data are from replicate 2; all trends were observed in both replicates. Normalization was performed using EdgeR ver. 3.34.1 on R ver.4.1.1. DEGs between the groups were defined if they had a false discovery rate q value of < 0.05, and log2 (fold change) < – 0.58 for downregulated genes, or log2 (fold change) > 0.58 for upregulated genes.
shRNA and adeno-associated virus (AAV) preparation
AAVs encoding U6-control shRNA-EF1α-EYFP were generated using the pAAV-shRNA-ctrl plasmid, which was gifted by Hongjun Song (Addgene plasmid # 85741; http://n2t.net/addgene:85741; RRID: Addgene_85741) [12]. To generate shRNA constructs against mouse Syt4 mRNA (shSyt4), single DNA strands were annealed and ligated into the pAAV-shRNA-ctrl plasmid, whose control shRNA sequences were removed by digestion with BamHI and XbaI to generate pAAV-shSyt4 plasmids. The shSyt4 sequence was GAA ATG CAC TCC CAA CGC A, and the hairpin sequence was CAA GCT TC. The knockdown efficiency of shSyt4 was validated by transfection of Neuro2a cells.
To generate AAV9, AAVpro 293T cells (Takara Bio, Shiga, Japan) were co-transfected with the three plasmids (pAAV-shRNA-ctrl or pAAV-shSyt4, pAAV2/9n, pHelper) in a 1:1:2.5 weight ratio using Polyethylenimine Max (Polysciences, Warrington, PA, USA). The pAAV2/9n plasmid was a gift from James M. Wilson (Addgene plasmid # 112865; http://n2t.net/addgene:112865; RRID: Addgene_112865). Cells were collected 3 days later, and the AAVs were purified using an AAVpro Purification Kit (Takara Bio) according to the manufacturer’s protocol. The AAVs were then aliquoted and stored at -80°C. Vector titers were determined as previously described [13]. Briefly, the virus genome was purified by proteinase K treatment and ethanol precipitation and amplified with the KAPA SYBR fast qPCR kit (KAPA Biosystems) and inverted terminal repeat primers. The titers were estimated to be between 4 and 7×1013 vg/ml.
SCI and AAV injection
Female mice were anesthetized using isoflurane and underwent laminectomy at the T10 vertebral level. Dorsal hemisection was performed at T10, with a lesion depth of 1 mm. After spinal cord transection, urinary bladders were manually expressed once daily until spontaneous voiding bladder contractions reappeared.
To visualize the projection of Syt4-silenced CST, AAV-shSyt4-EYFP or AAV-ctrl shRNA-EYFP (Control) was injected into the hindlimb area of the motor cortex (coordinates from bregma: 0.5 mm posterior/0.5 mm lateral, 0.5 mm posterior/1.0 mm lateral, 1.0 mm posterior/0.5 mm lateral, and 1.0 mm posterior/1.0 mm lateral; 0.4 μl per site, all at a depth of 0.5–0.7 mm into the cortex) using a glass capillary attached to a micro-syringe.
Behavioral assessment
To assess hindlimb function, the mice were tested using the ladder walking test [14] every 7 days between days 21 and 56 after SCI. A horizontal ladder (whole length of 1 m) with stainless steel rungs spaced 1–4 cm apart was used to evaluate hindlimb performance. Mice were habituated to the apparatus before surgery. The number of faulty placements in the injured hind paw was counted when the mice walked through the 1 m stretch. Deep slips/misses, slight slips, and placement errors (correction, replacement, and correct placement) were considered faults [15]. Control baseline scores were obtained immediately before injury. The spacing between the rungs was changed accordingly to prevent the animals from learning the rung locations. Behavioral testing was conducted between 1 pm and 6 pm.
Western blotting
Mice injected with recombinant AAV vectors were deeply anesthetized and transcardially perfused with PBS. Their brains were harvested, and the sensory motor cortex with EYFP expression was excised under a fluorescent stereomicroscope. Tissues were lysed in lysis buffer containing 10 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1% Triton-X 100, and 1 mM ethylenediaminetetraacetic acid containing a protease inhibitor (Roche, Basal, Switzerland). The samples were resolved by sodium dodecyl sulfate-sulfate-polyacrylamide gel electrophoresis and transferred onto polyvinylidene difluoride membranes (Immobilon-P, Merck Millipore, Burlington, MA, USA). The membranes were incubated with antibodies against rabbit anti-Syt4 (1:1000, 105143, Synaptic Systems, Göttingen, Germany) or β-actin (1:5000, #4970, Cell Signaling Technology, Danvers, MA, USA). For detection, horseradish peroxidase-conjugated secondary antibodies (Cell Signaling Technology) and a chemiluminescent horseradish peroxidase substrate (WBKLS0500, Merk Millipore) were used. The signal was imaged using LAS-4000 (Fujifilm, Tokyo, Japan), and protein expression was quantified using ImageJ software. Values were normalized to the integrated density of tubulin bands.
Immunohistochemistry
Cryosections were prepared from a fixed, sucrose-infiltrated frozen brain or the spinal cord. The mice were transcardially perfused with PBS and 4% paraformaldehyde in PBS. The isolated samples were post-fixed with 4% paraformaldehyde in PBS overnight at 4°C and transferred to 30% sucrose in PBS overnight. Tissues were embedded in optimal cutting temperature compound, frozen, sectioned at 25 μm (for the cervical spinal cord) and 20 μm (for other spinal cord sections) with a cryostat, and then mounted onto adhesive silane-coated glass slides (Matsunami Glass, Osaka, Japan). For immunohistochemical analysis, the sections were permeabilized and blocked with PBS containing 0.2% Triton X-100 and 3% normal donkey serum for 1 h at 20–25°C. The sections were incubated with primary antibodies overnight at 4°C and then incubated with fluorescently labeled secondary antibodies for 1 h at 20–25°C. For Syt4 staining, sections were pretreated for antigen retrieval by boiling in 10 mM citric acid solution (pH 6.0) at 95°C for 10 min before permeabilization. The primary antibodies used were rabbit anti-Syt4 (1:1000, 105143, Synaptic Systems), mouse anti-NeuN (1:1000, MAB377, Merck Millipore), rabbit anti-Iba1 (1:1000, 011-27991, Wako, Osaka, Japan), mouse anti-goat SOX9 (1:200, AF3075, R&D System, Minneapolis, MN, USA), mouse anti-Olig2 (1:1000, MABN50, Merck Millipore), rabbit anti-GFP (1:4000, ab6556, Abcam, Cambridge, GB), rabbit anti-PKCγ (1:1000, 59090, Cell Signaling Technology), and rat anti-GFAP (1:1000, 13-0300, Invitrogen, Waltham, MA, USA) antibodies. Alexa Fluor 488-conjugated donkey antibody against rabbit IgG, Alexa Fluor 568-conjugated donkey antibody against mouse IgG, Alexa Fluor 647-conjugated donkey antibody against goat IgG, and Alexa Fluor 594-conjugated donkey antibody against rat IgG (Thermo Fisher Scientific) were used as secondary antibodies. Nuclear staining was performed using 1 μg/ml DAPI. Images were acquired using a confocal laser scanning microscope (FluoView FV3000, Olympus, Tokyo, Japan).
To assess the localization of Syt4 in the motor cortex, brain sections ranging from -0.5 mm to -1.0 mm from the bregma were obtained from 8-week-old female C57Bl/6J mice. For quantification of glial scar formation after SCI, GFAP-positive and Iba1-positive regions per unit area were quantified in 1.5 × 1.5 mm2 squares centered on the lesion site.
CST tracing
To quantify CST sprouting, the number of EYFP-labeled CST collaterals crossing the line positioned in the gray matter was measured using a horizontal section prepared from the cervical spinal cord (segments C4 to C7). To exclude the difference in tracing efficiency, the number of CST collaterals per section was normalized by the total number of labeled CST axons; three sections spaced 100 µm apart were examined, and the average number of CST collaterals per section was divided by the number of labeled CST axons at the medulla.
To assess axon regeneration around lesion, the intensity of the EYFP signal was measured every 100 μm from the lesion site in three serial 20 µm-thick sections. Results are normalized with intensity at 1.0 mm rostral to the injury site.
Statistical analysis
Data are presented as mean ± standard error of the mean. Significant differences between groups were determined by an unpaired Student’s t-test or repeated-measures analysis of variance (ANOVA), followed by post hoc comparisons with the Tukey–Kramer test. P < 0.05 was considered statistically significant.