Materials
Isoproterenol (ISO) and propranolol (Pro) were purchased from Abcam (Cambridge, MA, USA). ICI118,551, LY2510924 and YC-1 were supplied by MedChem Express (Monmouth Junction, NJ, USA). Antibodies were obtained from the following sources: rabbit polyclonal antibodies specific to E-cadherin and Vimentin from Proteintech Group, Inc. (Wuhan, China); mouse monoclonal antibody to a-tubulin from Ray Antibody (Beijing, China); rabbit polyclonal antibodies to HIF-1a from Cell Signaling Technology (Danvers, MA, USA); goat anti-rabbit or anti-mouse IgG-conjugated horseradish peroxidase from CWBiotech (Beijing, China). The siRNAs against mouse HIF-1a, and control siRNA were provided by Genepharma Co, Ltd. DMEM/F-12, DMEM, 1% penicillin/streptomycin (P/S) and Minimum Essential Medium with Eagle Alpha modification (αMEM) were purchased from Thermo Fisher Scientific (Waltham, MA, USA). fetal bovine serum (FBS) was obtained from Pan-Seratech (Heilbronn, Germany).
Cell culture
Human prostate cancer cells PC-3 and DU145, mouse osteoblasts and MC3T3E1 cell lines were obtained from the Cell Bank, Chinese Academy of Sciences (Shanghai, China). PC-3 and DU145 cells were maintained in DMEM/F-12 and DMEM respectively, which were supplemented with 10% FBS and 1% P/S. Mouse MC3T3E1 cells were maintained in αMEM supplemented with 10% FBS and 1% P/S. Cells were maintained at 37 °C in a 5% CO2 atmosphere. To obtain osteoblast-conditioned medium (OBCM), cells were grown to 90% confluence and culture media were changed to αMEM supplemented with 10% FBS with/without ISO. OBCM was collected two days after the medium change and stored at −80 °C until use.
Culture of primary mouse calvarial osteoblasts
This study was approved by the Ethics Committee of Southern Medical University following the guidelines for the experimental use of animals. Twelve newborn ICR mice (1 day of age) were purchased from laboratory animal center (Southern Medical University, China), where they were kept in a sterile plastic cage under hygienic conditions. All animals used in this experiment were humanely euthanized by CO2 asphyxiation before isolating Calvaria. Calvaria were isolated from 2–3-day old newborn mice. Collected bone tissue was digested 5 times using 0.1 mg/mL collagenase I (GIBCO BRL, Grand Island, NY, USA) in αMEM with 1:40 diluted trypsin (Solarbio, Beijing, China). The cells isolated in the last 3 digestions were combined and cultured in αMEM containing 10% FBS, 1% P/S.
Migration and invasion assays
Assays were performed using 6.5-mm transwell inserts (24-well, 8 μm pore size, Corning, NY, USA) pre-coated with/without 100 μL Matrigel basement membrane matrix (BD Biosciences, San Jose, CA, USA) for migration and invasion assays, respectively. Primary osteoblasts or MC3T3E1 osteoblasts were grown to 90% confluence in 24-well tissue culture plates. In co-culture transwell assays, PC-3 and DU145 cells were cultured with serum-free DMEM/F-12 and DMEM, respectively, and MC3T3 E1 cells and primary osteoblasts were cultured with DMEM/F-12 or DMEM with 2.5% FBS. 24 h before migration, fresh 2.5% FBS DMEM containing 10 mM ISO (Abcam) or PBS was added to the cells. Primary osteoblasts or MC3T3E1 osteoblasts cell lines were pretreated with 50 μM ICI118,551 (MedChem Express) for selective blocking b2AR. On the day of assays, PC-3 or DU145 cells were detached with trypsin and resuspended in DMEM supplemented with 10% FBS for 1 h prior to assay. For inhibiting the CXCR4, 50 nM LY2510924 (a CXCR4 inhibitor, MedChem Express) was applied for 30 min prior to assay. 500 μL serum-free medium containing approximately 1x105 cells was placed in the upper chamber. Plates were incubated for 12 h or 24 h at 37 °C in a 5% CO2 incubator (Thermo Scientific, HERACELL 150i) for migration and invasion respectively. Unmigrated cells were removed with cotton-tipped swabs from the top of the membrane and the filters were washed with phosphate- buffered saline (PBS). Cells were fixed in 3.7% formaldehyde solution for 15 min and stained with 0.05% crystal violet in PBS for 30 min. Cells migrated were examined and counted under a microscope (Nikon ECLIPSE TE2000-U). Quantification of migratory and invasive cells of five distinct images from each replicate per group was performed.
Western blotting assay
Total protein from the cells was extracted with cold radio immunoprecipitation lysis buffer, protease inhibitor and phosphatase inhibitor cocktail (Cell Signaling Technology, Danvers, MA, USA). The protein samples were separated by 10% SDS-PAGE and transferred onto PVDF membranes (Millipore, Billerica, MA, USA), which was blocked with 5% skim milk prepared in PBS with Tween 20 (PBST). After blocking with 5% non-fat milk for 2 h at room temperature, the membranes were incubated with the following primary antibodies at 4 °C under gentle agitation overnight: E-cadherin (1:2000, 20874-I-AP; Proteintech), Vimentin (1:6000, 10366-I-AP; Proteintech), a-tubulin (1:6000, RM2007; Ray Antibody), HIF-1a (1:1000, D2U3T; Cell Signaling Technology). Following washes in PBST 3 times, the membranes were incubated with goat anti-rabbit IgG-HRP (1:6000, CW0103; CWBiotech) or goat anti-mouse IgG-HRP (1:6000, CW0102; CWBiotech) for 1 h at room temperature. Protein expression was quantified by densitometric analysis using the ImageJ software (National Institutes of Health, Bethesda, MD, USA).
Cell proliferation assays
Cell proliferation was determined using a Cell Counting Kit-8 (CCK-8, Beyotime Institute of Biotechnology, Shanghai, China) according to the manufacturer’s instructions. For the CCK-8 assay, 2 × 104 cells/well were seeded in a 96-well plate for 24 h and were treated with ISO or conditioned medium from MC3T3 E1/primary osteoblast with/without ISO, for 12 h and 24 h at 37oC. and the absorbencies at each time point were measured at 450nm by a microplate reader. All experiments were biologi- cally repeated at least three times.
Quantitative real-time PCR (qRT-PCR)
qRT-PCR was performed to determine the mRNA expression of RANKL, CXCL12, CXCL16, WISP-1, Annexin II, TGF-b1, CXCR4, N-cadherin, Snail, Slug, Zeb-1, Twist-1. Total RNA from the samples was isolated using RNAiso plus (TaKaRa, Kusatsu, Shiga, Japan), followed by reverse transcription with the HiScript II Q RT SuperMix kit (Vazyme, Nanjing, China). qPCR was conducted using 2×T5 Fast qPCR Mix SYBR Green (Tsingke, Beijing, China) and run with the Applied Biosystems 7500 Fast Real-Time PCR System (Applied Biosystems). PCR conditions included an initial denaturation step of 3 min at 95 oC, followed by 40 cycles of PCR consisting of 30 s at 95 oC, 30 s at 60 oC, and 30 s at 72 oC. The PCR data were analyzed by the 2-ΔΔCT method (Livak and Schmittgen, 2001). All mouse primer sequences used are as follows, Mouse RANKL (5'- AGCCGAGACTACGGCAAGTA-3' and 5'- AAAGTACAGGA
ACAGAGCGATG-3'); Mouse CXCL12 (5'-TGCATCAGTGACGGTAAACCA-3' and 5'-CACAGTTTGGAGTGTTGAGGAT-3'); Mouse CXCL16 (5'- CCTTGTCTCTTGC
GTTCTTCC-3' and 5'- TCCAAAGTACCCTGCGGTATC-3'); Mouse Annexin II(5'-ATGTCTACTGTCCACGAAATCCT-3' and 5'- TGACTGACCCGTAGGCACTT-3'); Mouse TGF-b1 (5'- CTGGCGAGCCTTAGTTTGGAC-3' and 5'- TGACTGACCCGTAGGCACTT-3'); Mouse WISP-1 (5'- ACTGGGCGTCAGCCTAATC-3' and 5'-CCCCACTGTAATCGCAGTAGAG-3');Mouse GAPDH (5'- AGGTCGGTGTGAACGGATTTG -3' and 5'- GGGGTCGTTGATGGCAACA -3'); Human CXCR4 (5'-GAACTTCCTATGCAGGCAGTCC-3' and 5′-CCATGATGC TGAAACTGAAC-3′); Human N-cadherin (5'-TCAGGCGTCTGTAGAGGCTT-3' and 5'- ATGCACATC
CTTCGATAAGACTG-3'); Human Snail (5'- TCGGAAGCCTAACTACAGCGA-3'); Human Slug (5'- CGAACTGGACACACATACAGTG-3' and 5'- CTGAGGATCTCT
GGTTGTGGT-3'); Human Zeb-1 (5'- GATGATGAATGCGAGTCAGATGC-3' and 5'- ACAGCAGTGTCTTGTTGTTGT-3'); Human Twist-1 (5'- GTCCGCAGTCTTACGAGGAG-3' and 5'-GCTTGAGGGTCTGAATCTTGCT-3'); Human GAPDH (5'- GGAGCGAGATCCCTCCAAAAT-3' and 5'- GGCTGTTGTCATACTTCTCATGG-3').
Transient siRNA Silencing
The three specific siRNAs (HIF-a siRNA, CXCR4 siRNA and negative control siRNA) were designed by GenePharma (Shanghai, China). Transient silencing of HIF-a and CXCR4 was achieved by transfection of siRNA oligos using LipofectamineTM 3000 reagent (Invitrogen) following the manufacturer’s instructions. Briefly, 50,000 cells/cm2 were plated into 6-well plates and allowed to adhere for 24 h. Subsequently, 5 µl of siRNA was added to 500 µl of Opti-MEM (Gibco; Thermo Fisher Scientific, Inc.) thoroughly mixed, and incubated at room temperature for 5 min. Lipofectamine™ 3000 (5 µl; Gibco; Thermo Fisher Scientific, Inc.) was added to 500 µl of Opti-MEM, thoroughly mixed and incubated at room temperature for 5 min. The diluted siRNA and diluted Lipofectamine™ 3000 were mixed and incubated at room temperature for 15 min. The siRNA/Lipofectamine mixture was transferred into 6-well plates at 1000 µl/well. The cells were maintained for 6 h at 37°C. Following replacement of the culture medium, the cells were incubated for an additional 24–72 h. HIF-a siRNA and CXCR4 knockdown were verified using qRT-PCR and western blot analyses. All siRNA sequences used are as follows, HIF-a siRNA sequence (sense 5’-GUGGUAUUAUUCAGCACGATT-3’ , antisense 5’-UCGUGCUGAAUAAUACCACTT-3’), CXCR4 siRNA (sense 5'-CUGUCCUGC UAUUGCAUUATT-3', antisense 5'-UAAUGCAAUAGCAGGACAGTT-3') and negative control siRNA sequence (sense 5’-UUCUUCGAACGUGUCACGUTT-3’, antisense 5’-ACGUGACACGUUCGGAGAATT-3’).
Transfection with HIF-1α overexpression vector
The HIF-1α overexpression plasmid, a generous gift provided by Dr Ruonan Gu (Zhujiang Hospital, Southern Medical University, Guangzhou, China), was used for transfection. MC3T3 E1 and primary osteoblast cells (3×105 cells/well) were seeded into 6-well plates and allowed to grow at 50–70% confluence. The cells were transfected with HIF-1α plasmid and vector control using LipofectamineTM 3000, according to the manufacturer’s instructions. After 6 h, the original medium was replaced with fresh complete medium. The expression of HIF-1α was determined by Western blotting after 48-72 h.
ELISA assays
ELISA assays for CXCL12 (Cat. No. RK00168, ABclonal Technology) were performed according to the manufacturer’s instructions. In brief, cell culture supernates from MC3T3E1 and primary osteoblasts were centrifuged at 1000 g for 10 min and detected: (a) preparing the standard and regents; (b) washing plates 4 times; (c) adding 100 mL of standards and test samples to each well; (d) adding 100 mL Biotin-Conjugate antibody working solution; (f) adding 100 μL Streptavidin-HRP working solution; (g) adding 100 μL substrate solution; (h) adding 100 μL stop solution; (i) detecting the optical density within 5 min under 450 nm.
Statistics
All of the experiments were at least done in triplicates individually, unless otherwise stated. The data are presented as mean ± standard error of the mean (SEM). Data were analyzed by comparing the means using one-way ANOVA followed by Dunnett’s test or two-way ANOVA followed by Bonferroni’s post hoc test or a t-test. For all analyses, P < 0.05 was considered statistically significant.