Cell isolation and identification
Separate bone marrow mesenchymal stem cells (BMSCs) were obtained from Sprague‒Dawley rats (8 weeks, 210 g-230 g, Dassy Experimental Animals, China) via a modified whole bone marrow adherence method. This study was authorized and supervised by the Committee of Sichuan Provincial People's Hospital (Approval No. 20200133). Cells were cultured at 37°C in a 5% CO2 environment in complete medium, which was DMEM with 10% fetal bovine serum (FBS VWR) and 1% penicillin‒streptomycin (PS HyClone). Flow cytometry was used to detect the cellular expression of MSC surface markers (CD29, CD90, CD44, and CD45). We collected 3–5 generations for future experiments.
DP7-C/miR-26a complex transfection into BMSCs
This study utilized passages 3–5 of BMSCs for exosome isolation. Our previous study used computer simulation to create DP7-C, a cholesterol-modified novel cationic and hydrophilic antimicrobial peptide. MiR-26a mimics (UUCAGUAAUCCAGGAUAGGCU) and negative control NC (synthesized by Tsingke Biotechnology) were transfected into BMSCs with DP7-C. In detail, BMSCs (2 X 107 cells) were seeded in a 10 cm plate for 24 h. Then, DP7-C (165 µg) and miR-26a (33 µg) were combined at a ratio of 5:1 (w/w) into DMEM and incubated on ice for 15 min. Finally, the complex was slowly and evenly added into the plates, and cultivation was continued.
Isolation and purification of exosomes derived from BMSCs
After transfection, the culture medium was replaced with exosome-free medium, which was DMEM with 10% exosome-depleted FBS from SBI (System Biosciences, CA, USA) and 1% penicillin‒streptomycin (PS HyClone). Forty-eight hours later, the supernatant was collected to obtain and purify exosomes by ultracentrifugation. Specifically, the supernatants were filtered through a 0.22㎛m filter after centrifugation at 10,000 × g for 30 min at 4°C to remove cell debris and then centrifuged at 100,000 g with an ultracentrifuge (Optima XPN-100 BECKMAN, USA) for 70 min at 4°C to separate the exosomes. Finally, the exosomes were resuspended in PBS (pH 7.2–7.4, Solarbio, P1020) for further study.
Exosome internalization
Following the manufacturer's protocol, the exosomes were labeled with PKH67 (Umibio, UR52303), a green fluorescent membrane-labeling dye DiI. Next, BMSCs were incubated for 6, 12, 24, and 48 hours with DiI-labeled exosomes. BMSCs were fixed in 4% paraformaldehyde (Solarbio, P110), and then 5 µg/mL phalloidin (Solarbio, CA1670) was used to stain the cytoskeleton, and 5 µg/mL 4',6-diamidino-2-phenylindole dihydrochloride (DAPI, Solarbio, D8200) was used to label the nucleus. The uptake of exosomes by BMSCs was observed via confocal laser-scanning microscopy (ZEISS, Germany).
Cell-Counting Kit-8 assay
BMSCs were trypsinized, counted, adjusted to a density of 1 × 104 cells/mL, seeded in 96-well culture plates and treated with the corresponding interventions. Cell Counting Kit-8 (CCK8, Solarbio, CA1210) was used to evaluate cell proliferation every 24 h. The absorbance value at 450 nm was read by a microplate reader and plotted for the cell growth curve.
Wound healing assay
After the BMSCs reached 90% confluence, they were serum starved for 24 h. The cells were scraped off with the tip of a 10 µL sterile pipette, and a parallel wound was created. The cells were washed three times with PBS to eliminate cell debris. The cell culture wells were divided into blank (PBS), ExoNC, and ExomiR−26a groups. Then, 50 µg/mL ExoNC and ExomiR−26a were added to the groups. After 24 h and 48 h, images were captured with a microscope. The percentage of wound closure was quantified by ImageJ.
Transwell migration assay
BMSCs (5 × 104 cells) were seeded in the upper chambers of Transwell plates (8 µm pores, Corning), and the complete culture medium was placed in the lower chamber as a chemoattractant. Each group was treated with the corresponding interventions. Twenty-four hours later, the cells were stained with crystal violet (Solarbio, C8470). Then, the cells were observed under a light microscope (ZEISS, Germany). ImageJ was used to perform quantitative cell analysis.
ALP activity detection
BMSCs were seeded in 6-well culture plates. The medium was replaced by osteogenic induction medium (DMEM with 10% FBS, 1% penicillin‒streptomycin, 20 mmol/L β-glycerophosphate, 50 g/mL vitamin C and 10 mol/L dexamethasone). Next, the blank (PBS), ExoNC, and ExomiR−26a suspensions were added to the cells at 50 µg/mL, and the medium was replaced every 3 days. After 7 days of osteogenesis induction, an ALP activity assay kit (Beyotime, China) was used to assess alkaline phosphatase activity. The BMSCs were harvested and then lysed with cell lysis buffer. The supernatant was collected after centrifugation at 10,000 × g for 5 min at 4°C, and the ALP activity was measured according to the manufacturer’s instructions.
Alizarin red staining
After 21 days of osteogenesis induction, the BMSCs were fixed with 4% paraformaldehyde on ice for 30 min and then dyed with Alizarin Red S Staining Solution (Solarbio, G3280) for 3 min. After washing 3 times with PBS, the calcified nodules of bone marrow mesenchymal stem cells were observed by light microscopy (ZEISS, Germany) and photographed.
Western blotting
Exosomes and cells were collected and lysed in cell lysis buffer (Solarbio, R0100). SDS‒PAGE was used to isolate the proteins. Western blotting primary antibodies used included antibodies against GAPDH (1:20000 dilution, Huabio, China), CD63 (1:1000 dilution, Abcam, UK), CD81 (1:1000 dilution, Abcam, UK), TSG101 (1:1000 dilution, Abcam, UK), Calnexin (1:1000 dilution, Abcam, UK), ALP (1:4000 dilution, Huabio, China), BMP2 (1:1000 dilution, Huabio, China), RUNX2 (1:500 dilution, Huabio, China), and COLIA1 (1:1000 dilution, Huabio, China), and an HRP-conjugated goat anti-rabbit/mouse secondary antibody (1:5000 dilution, Huabio, China) was used. The bands were then visualized using a Super ECL kit (Solarbio, PE0010). Tanon-5200 was used for exposure.
Real-time quantitative PCR (RT‒qPCR)
Following total RNA extraction from cell samples with TRIzol™ Reagent (Invitrogen, USA), the RNA was used to synthesize cDNA with M-MLV (Thermo Fisher Scientific). The cDNA was then used as a template for PCR using the diverse primers listed in Table 1 (designed and synthesized by Tsingke, China), and the 7500 Real-Time PCR System was used to assess the level of mRNA expression. The average threshold cycle (Ct) for each gene was determined from triplicate reactions. Using the 2 − ΔΔCt method, the relative expression level of mRNA or miRNAs was standardized to that of the internal controls GAPDH or U6.
Table 1
Gene name | Primers |
ALP | Forward: 5’-CTTGAAGTGTTGCATGGGC-3’ |
Revise: 5’-CAAGTCTCAGGGTGGAAAGG-3’ |
COL1A1 | Forward: 5’-CCCCTGGAAAGAATGGAGATG-3’ |
Revise: 5’-TCCAAACCACTGAAACCTCTG-3’ |
RUNX2 | Forward: 5’-CCCAGTATGAGAGTAGGTGTCC-3’ |
Revise: 5’-CGCCTGGGTCTCTTCACTAC-3’ |
BMP2 | Forward: 5’-GGGTAAGACTGGTCATAGGACC-3’ |
Revise: 5’-GCTTGGACATGAAGGCTTTG-3’ |
miR-26a | Forward: 5’-UUCAAGUAAUCCAGGAUAGGCU-3’ |
Revise: 5’-CCUAUCCUGGAUUACUUGAAUU-3’ |
NC | Forward:5’-UUCUCCGAACGUGUCACGUTT-3’ |
Revise:5’-ACGUGACACGUUCGGAGAATT-3’ |
U6 | Forward:5’-AGCACATATACTAAAATTGGAACGAT-3’ |
Revise: 5’-ACTGCAGGGTCCGAGGTATT-3’ |
GAPDH | Forward: 5’-CCACCCATGGCAAATTCCATGGCA-3’ |
Revise: 5’-TCTAGACGGCAGGTCAGGTCCACC-3’ |
Animal experiments
After 3 days of environmental acclimation, 18 male C57BL/6 mice (8 weeks, 20–25 g) were randomly divided into the following groups: blank (PBS), ExoNC, and ExomiR−26a; each group included 6 mice. According to previous research(Chipashvili & Bor, 2022), a 5 − 0 silk ligature was tied around the left maxillary second molar and tightened to induce experimental periodontitis. After three days of induction, 10 µL of exosome suspension was injected into the palatal gingiva. The injection was repeated every three days until the eleventh day. All the mice were sacrificed for the subsequent evaluations. Microcomputed tomography (µCT, ZEISS) was used to measure bone formation, as well as bone volume/total volume (BV/TV), bone mineral density (BMD), and distance from the CEJ to the AB. Following dehydration, the samples were decalcified in 10% EDTA (pH 7.4) for 14 days before being embedded in paraffin. Five-millimeter sections were cut and prepared for hematoxylin and eosin (HE) staining to evaluate alveolar bone loss.
Bioinformatic analysis of miR-26a target genes
To reduce the false-positive rate, TargetScan, miRmap, PicTar, miRanda, and DIANA-microT were used to predict miR-26a target genes. To investigate the functional evaluation and pathway enrichment of those predicted genes, the HiPlot online analysis tool was used with P0.05 as the significance threshold to obtain important gene sets from the Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) databases.
Statistical analysis
GraphPad Prism 8 was used to analyze the results. The results of three separate experiments are shown as the average standard deviation (SD). The independent two-tailed Student's t test was used to compare the two groups. A two-tailed P value of < 0.05 was regarded as statistically significant.