Plant material
Based on our previous studies (Zare et al. 2015), a number of transgenic events carrying intron-hairpin RNA (ihpRNA) construct containing the 5' UTR with or without coding sequence of CP of BNYVV, called IHP-P (S3) and IHP-U (S6), respectively, were selected. Three T1 progenies of S3-12 and one of the S3-13.2 events were chosen named 227, 228, 229, and 219, respectively. Also, two T1 progenies of S6-2 and S6-44 events named 221 and 231 were selected. A diploid monogram cultivar as a wild-type parental plant, named ‘9597’, and a cultivar called ‘Dorothea’ carrying the Rz1 gene, a Holly-based resistant plant, served as the negative and positive controls, respectively. The Sugar Beet Seed Institute of Iran kindly provided these non-transgenic cultivars.
Vegetative propagation of transgenic events
Transgenic plants were propagated through tissue culture to obtain a sufficient number of genetically identical individuals. The culture medium was composed of MS salts (Murashige and Skoog 1962) supplemented with 0.1 mg/l IBA, 1 mg/l BA, and 0.1 mg/l GA3. The root-inducing medium was MS containing 3 mg/l NAA hormone. Clonally propagated plants were transferred into the soil composed of peat, perlite, and vermiculite at a 1:1:1 ratio and adapted under the yellow-white fluorescent bulbs with 16 hours of light photoperiod. The temperature was 25-30°C and the humidity was adjusted to 40-60%.
Molecular analysis for transgenic plants
To select progenies carrying the transgene, a Southern blot analysis was performed. Genomic DNA was isolated from 50 mg of sugar beet leaves, according to Dellaporta et al. (1983). Genomic DNA (30 µg) was directly spotted on a positively charged nylon membrane (Roche Diagnostics, Germany) using a vacuum-assisted dot blotter tool (Gentaur BVBA, Belgium). Probes were synthesized PCR and DIG-labeled dNTP mixture using a DIG DNA labeling and detection kit (Roche Biochemical, Germany). The temperature for hybridization was 65°C and the concentration of salt for the last wash was 0.1 mM NaCl in sodium citrate buffer. Detection was done by NBT/PCIP as instructed and the darkness of dots was inspected visually.
For genotyping of the progenies, DNA extraction of transgenic events was performed from the leaves using a GTP kit (Gene Transfer Pioneers, Iran). The presence of the transgene in each progeny was monitored by PCR amplification using gene-specific pairs of primers (Table 1). The reaction mixture contained 1 µl (50 ng) genomic DNA template, 2 pmol of each primer, 10 µl 2X PCR master mix (Thermo Fisher Scientific, USA), 2 mM MgCl2, 200 µM of each dNTPs, and 5 U Taq DNA polymerase (Cinagen, Iran) in a volume of 30 µl. Amplification cycles were as follows: denaturation cycle at 95°C for 5 min, 40 cycles of 94°C, 60°C, and 72°C (1 min each) with a final extension step at 72°C for 10 min. The PCR products were separated on 1% agarose gels, stained with ethidium bromide, and visualized by UV light.
Viral challenges and bioassays
The propagated clones with 6-8 leaves were challenged with BNYVV or BSCTV-Ir viruses individually or both. Plants were transplanted into the mixture of BNYVV-infested and sterile soil at a 1:1 ratio. BSCTV-Ir infection was done through agro-infection of sugar beet plants with a full-length recombinant BSCTV-Ir construct (Ebadzad Sahraei et al. 2008) using Agrobacterium tumefaciens strain C58. To this end, the Agrobacterium was cultured in LB medium supplemented with Rifampicin and Kanamycin at 50 µg/ml and grown to OD600 1.0. The bacteria were pelleted and resuspended in MS medium supplemented with 2% sucrose, 10 mM MgCl2, and 150 µM acetosyringone at pH 5.8 and diluted to OD600 0.5. After 3 hours of incubation at room temperature, it was injected into the back of the leaves.
Table 1
General details of primers used in this study.
|
Name
|
Primer sequence (5'-3')
|
Tm (°C)
|
Target
|
Amplicon Size (bp)
|
C-2
|
AGCTAATTGCTATTGTCCGGGT
|
60
|
CP21-
|
736
|
CS-1
|
CGCATATCTCATTAAAGCAGGACTCTA
|
60
|
ORF
|
|
C-1
|
TTCTCATTAGTACCAGCAGTTTT
|
60
|
CP21-
|
460
|
U+2
|
CTCGAGAATAGAATTTCACCGTCTG
|
60
|
ORF
|
|
PIF
|
CAAGGTAACATGATAGATCATGTCATTGTG
|
67
|
CP21-
|
333
|
TOCS
|
AAACCGGCGGTAAGGATCTG
|
67
|
UTR
|
|
BSCTV-Ir
|
AGAAAATATACAAGAAATC
|
41
|
V1/CP
|
761
|
BSCTV-I
|
TTAATAAAAATAACATCTAC
|
41
|
|
|
After 30 days of BSCTV-Ir infection, the presence of the virus was detected by PCR for an expected band of 761 bp using a pair of primers (Table 1). Total DNA was isolated from 50 mg of sugar beet leaves using the i-Genomic Plant DNA Extraction Mini Kit (Intron Biotechnology, South Korea). The PCR reaction mixture and program were carried out as above.
After 60 days of inoculation, BNYVV titers for each event were estimated using the enzyme-linked immunosorbent assay (ELISA) either by a DAS-ELISA kit (BIOREBA, Switzerland) based on the instructions provided by the manufacturer or according to Clark and Adams (1977) using an anti-CP21 antibody provided by Dr. Izadpanah (Shiraz University, Iran). Following overnight incubation of the reaction mixture, absorbance for each sample was measured at 405 nm. The cut-off value was mean+3SD for non-infected wild-type plants. If the absorbance was more than two times the cut-off value, the plant was considered susceptible, whereas if it was below the cut-off, the plant was resistant, and if between one and two cut-off values, the plant was designated as tolerant. To assure the infection process, P. betae spores were stained with lactophenol fussing acid and observed microscopically.
Statistical analyses
Analysis of variance (ANOVA) for bioassay data was performed in a factorial experiment with a completely randomized design and three replications. In the following, the means were compared using Duncan’s multiple range test (P<0.05). All the statistical analyses were conducted with the use of SPSS software (IBM, USA).
Bioinformatics data analysis
To examine the possible similarity between the CP of BNYVV (GenBank Accession No. AY277887) and BSCTV (GenBank Accession No. X97203), their nucleotide sequences were pairwise aligned with MegAlign software in Lasergene package (DNASTAR, USA).