Cell culture and radiation treatment
We cultured the radioresistant pancreatic cancer cells (SW1990-R and PANC-1-R) as well as the parental cells (SW1990 and PANC-1) in RPMI-1640 media supplemented with 10% fetal bovine serum. Cells were cultured at 37°C in an incubator with 5% CO2. Ionizing irradiation (IR) was performed using a linear accelerator unit (Elekta, Synergy, Sweden) at a dose rate of 200 cGy/min (SSD=100 cm) in the Shengjing hospital of China Medical University(Wang et al. 2018).
Colony formation assays
Cells were seeded on 6-well plates at a density of 5000 cells per well in triplicate. After 24 h, the cells were treated with or without AG490 (0,6.25,12.5,25,50μm/ml) and with or without a single dose of radiation (5 Gy). The cells were then seeded for about 10 days. The cultures were were fixed in 100% methanol and stained with 1% crystal violet. Colonies containing >50 cells were counted under a light microscope. The surviving fraction was calculated as described previously.
Real-time PCR
Total RNA was isolated from 2 × 106 target cells using the Trizol reagent (TaKaRa, Kusatsu, Japan). cDNAs generated by reverse transcription were used for real-time PCR with the ExScript RT-PCR kit (TaKaRa, Kusatsu, Japan). The qPCR primers for JAK2 are as follows: TCTGGGGAGTATGTTGCAGAA(Forward) and AGACATGGTTGGGTGGATACC (Reverse); the qPCR primers for STAT3 are as follows: CAGCAGCTTGACACACGGTA (Forward) and AAACACCAAAGTGGCATGTGA (Reverse); the qPCR primers for SCOS3 are as follows: TGCAGGAGAGCGGCTTCTACTG (Forward) and CACCAGCTTGAGCACGCAGTC (Reverse);the qPCR primers for GAPDH are as follows:GCACCGTCAAGGCTGAGAAC (Forward) and TGGTGAAGACGCCAGTGGA (Reverse). All amplifications and detections were carried out in the LightCycler 480 system (Roche, Basel, Switzerland) using the LightCycler 480 SYBR Green I Master (Roche, Basel, Switzerland). The statistical analyses were performed using the 2-∆∆Ct relative quantification method.
Transfection
SW1990-R and PANC-1-R cells were transfected with siJAK2 (Santa Cruz, CA, USA) with Lipofectamine™ RNAiMAX (Invitrogen, Carlsbad, CA) according to the manufacturer’s instruction. After transfection, cells were treated by radiation at 5 Gy, then were harvested for Western blot assay after 24h of radiation. After removing complexes and changing medium for 10 days, colony formation assays were calculated.
Western blot
Protein expression levels in SW1990 and SW1990-R cells were determined by western blotting as previously described. After loading proteins, different primary antibodies were incubated at 4 °C, followed with an appropriate secondary antibody. Primary antibodies to JAK2 and STAT3 were purchased from Abcam (Abcam, Cambridge, UK) pSTAT3 was purchased from Cell Signaling Technology(Beverly, MA, USA). SOCS3 was purchased from Wanleibio (Wanleibio ,Shenyang, China).β-Actin and GAPDH antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA).
Immunohistochemistry
We selected pancreatic cancer patients with radiotherapy. The tissue specimens were processed in the Department of Pathology at Shengjing Hospital (Shenyang, China). Samples were formalin-fixed and paraffin embedded, and cut and mounted on slides. The JAK2 primary antibody (Catalog No. BA3398, Boster Biological Technology, Wuhan, China) was diluted to 1:100. Slides were incubated in primary antibody in a working solution of 100 µL.
Statistical analysis
Significant differences between two groups were analyzed using two-sided unpaired Student’s t-test or 2-way ANOVA. Statistical analysis was performed with GraphPad Prism 5 software. The P value < 0.05 was considered statistically significant.