Cell culture and lentiviral shRNA infection
Human bronchial epithelial cell line BEAS-2B, non-small cell lung cancer cell line A549, H460, H1299 and mouse lewis lung cancer cell line LLC purchased from American Type Culture Collection (ATCC, VA, USA). All human cell lines used in this study have been authenticated by STR profiling in the year of 2019. All experiments were performed with mycoplasma-free cells.
BEAS-2B and H1299 were maintained in RMPI 1640 medium with 10% fetal bovine serum (Gibco, Grand Island, NY, USA), A549, H460 and LLC were maintained in DMEM medium with 10% fetal bovine serum (Gibco, Grand Island, NY, USA) at 37°C in a 5% CO2 humidified chamber.
In this study, we constructed human Sirt3 scrambled shRNA (TTCTCCGAACGTGTCACGT), three shRNAs (GTGGGTGCTTCAAGTGTTGTT, GTGGGTGCTTGGGTGTTGTT, AGTGTGCTTCAAGTGTTGTT), and overexpresses lentiviral plasmid (Gene sequence from NCBI database) lentiviruses (made from the vector GV248). Besides, we also constructed mouse Sirt3 scrambled shRNA (TTCTCCGAACGTGTCACGT), three shRNAs (CTTCAATGCTTCAAGTGTTGTT, GTGGGTGCTTGATGGTTGTT, AGTGTGCTTCAAGTGTTATG), and overexpresses lentiviral plasmid (Gene sequence from NCBI database) lentiviruses. All these lentiviruses were generated by BioLink (Shanghai, China). Sirt3 plasmid lentiviral vectors were used for knockdown and overexpression of Sirt3. Cells were seeded at 1×105 cells/well into six-well plates and infected with lentiviral particles using polybrene (10 mg/mL). After infection, virus-containing medium was replaced with normal medium, and then cells were selected with puromycin (2 mg/mL). After cell infection, the knockdown effect of the three shRNAs in human and mouse were tested by Western Blot, then we selected the viral plasmids of the best knockdown effect, human Sirt3 shRNA (GTGGGTGCTTCAAGTGTTGTT) and mouse Sirt3 shRNA (CTTCAATGCTTCAAGTGTTGTT), for next experiments.
Animals and tumor planting
The whole protocols were approved by the Ethics Committee of Second Military Medical University. Male C57BL/6 mice, 8 weeks old, obtained from the Experimental Animal Center of Chinese Academy of Sciences (Shanghai, China), were used for the animal experiment. Mice were fed in daily-changed individual cages, at 25±1℃ with food and water provided for free access. The mice were randomly divided into three groups: group 1, negative control; group 2, Sirt3 knockdown; group 3, Sirt3 overexpression.
The mouse was anesthetized with isoflurane gas (VETEASY, Shenzhen, China), then placed the right side of the mouse on the operation table. The skin and superficial soft tissue were cut at the midline of left rib, and the insulin injection needle was inserted into the second last rib gap, and the depth of the needle was 2 mm, then the LLC cell was injected into the left lower lobe of the mouse at 1×106 per 25 μl. After skin sutured and disinfected, the mouse was resuscitated.
Irradiation
The 60Co γ-rays in Radiation Center (Faculty of Naval Medicine, Second Military Medical University, Shanghai, China) were applied for the irradiation exposure. Cells were irradiated with 2, 4, 8 Gy at a dose rate of 1 Gy/min. After anesthetization with 10% chloral hydrate (350mg/kg), mice were subjected to whole-lung irradiation with 15Gy at a dose rate of 1Gy/min.
Western Blot
Cells were homogenized in mammalian protein extraction reagent (M-PER) to prepare a protein sample. The lysates were mixed with 10% SDS-PAGE then electrophoresis was performed on the same amount based on the concentration. After the electrophoresis, the protein was transferred to a nitrocellulose membrane (Amersham, Arlington Heights, IL, USA) then blocked with 5% milk for 1 hr at room temperature. The proteins were incubated with Sirt3 (1:1000), p-ATM (1:1000), p-ATR (1:1000), p-Chk1 (1:1000), p-Chk2 (1:1000), γ-H2AX (1:1000) and β-tublin (1:1000) (Cell Signal Tech, Danvers, MA, USA) at 4°C overnight in a shaker incubator. After washing with TBS-T, the membranes were incubated with anti-rabbit or anti-mouse IgG horseradish peroxidase conjugated antibody (1:5000; Cell Signal Tech.) for 1 hr at room temperature. The protein bands were visualized using enhanced chemiluminescence with a Super Signal west pico kit (Bridgen Biological Technology, Shanghai, China). Films were scanned and analyzed by densitometry using Syngene GeneGenius software (Syngene, Frederick, MD, USA).
Cell viability assay
Cell viability was determined by Cell Counting Kit-8 (Dojindo, Kumamoto, Japan). Cells were suspended and seeded into 96-well plates with 5×103 cells/well. At the 48h after irradiation, cell viability was tested with a CCK-8 assay.
Clonogenic assay
Cells were trypsinized, counted, and seeded in 60-mm culture dishes for each dose of radiation. Sufficient numbers were seeded to ensure that approximately 30-100 macroscopic colonies would appear in each plate after 10-14 days. Colonies were stained with 0.5% gentian violet in methanol and counted. The plating efficiency (PE) for each dose was calculated by dividing the number of colonies by the number of cells plated and expressing the result as a percentage. The surviving fraction was calculated by dividing the PE of the irradiation groups by the PE of the appropriate unirradiated control.
Apoptosis analysis
Apoptosis of cells with or without irradiation was determined by Annexin V-PE and 7-AAD staining. The cells were plated in six-well plates at a density of 105 cells per well and allowed to attach for 24h. The cells were harvested by trypsin digestion, washed with PBS twice, and resuspended 24h after irradiation. Then the cells were stained with Annexin V-PE and 7-AAD at room temperature for 15 min in a dark room according to the Annexin V-PE/7-AAD Apoptosis Detection Kit (YEASEN, Shanghai, China) instructions.
Cell cycle analysis
Cell cycle was analyzed by PI staining. The cells were plated in six-well plates at a density of 2×106 cells per well and allowed to attach for 24h. The cells were harvested by trypsin digestion in 0, 8, 12, 24h after irradiation, then washed with PBS twice, fixed with pre-cooled 75% ethanol for 24 h, then washed again twice with PBS, and stained with PI for 30 min at 4 ℃, and assayed by flow cytometer.
Histopathology
At indicated time points, lung tissues were isolated and subjected to sectioning, then the samples were stained with H&E, terminal transferase-mediated dUTP nick end labeling (TUNEL), Ki67 (1:400, Cell Signal Tech, Danvers, MA, USA), Sirt3 (1:200, Cell Signal Tech, Danvers, MA, USA), p-ATM (1:100, Cell Signal Tech, Danvers, MA, USA), p-Chk2 (1:200, Cell Signal Tech, Danvers, MA, USA), and γ-H2AX (1:200, Cell Signal Tech, Danvers, MA, USA) staining. Five fields per section at 200 magnifications were randomly selected per mouse, and two blinded pathologists independently examined 30 fields per group using Nikon DS-Fi1-U2 microscope (Nikon, Tokyo, Japan).
Immunofluorescence staining
Immunofluorescence analysis was performed to measure the expression of γ-H2AX in A549 cells. After fixed with 4% formaldehyde solution, the slides were incubated with γ-H2AX (1:200, Cell Signal Tech, Danvers, MA, US) antibodies at 4°C overnight. After washed with PBS, slides were incubated with Texas Red-conjugated anti-rabbit secondary antibodies (Cell Signal Tech, Danvers, MA, US) at room temperature for 30 min. Nuclei were counterstained with DAPI, and the slides were analyzed by using a fluorescence microscope (Nikon Eclipse Ti-SR, Nikon, Tokyo, Japan).
Statistical analysis
Data was expressed as the means ± standard error of the mean (SEM). Comparison between-group were performed using one‐way ANOVA. Two‐group comparisons were performed using independent‐samples Student's t‐test. P<0.05 was considered significant. All experiments were performed at least 3 independent times.