Exposure of dogs and cats to Borrelia miyamotoi infected Ixodes ricinus ticks in urban areas of the city of Poznań, west-central Poland

doi:10.21203/rs.3.rs-2088418/v1

Download PDF

Research Article

Exposure of dogs and cats to Borrelia miyamotoi infected Ixodes ricinus ticks in urban areas of the city of Poznań, west-central Poland

https://doi.org/10.21203/rs.3.rs-2088418/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 30 Jun, 2023

Read the published version in Ticks and Tick-borne Diseases →

Version 1

posted

You are reading this latest preprint version

Background

Borrelia miyamotoi is an emerging human pathogen causing relapsing fever-like disease termed B. miyamotoi disease. The bacterium belongs to relapsing fever borreliae and similarly as spirochete species from the group of Borrelia burgdorferi sensu lato, is transmitted only by hard-bodied ticks within the Ixodes ricinuscomplex. Borrelia miyamotoi has not been so far shown to cause illness in dogs or cats, and is poorly documented in veterinary medicine. The aim of our study was to determine the B. miyamotoi infection prevalence in (i) host-seeking and (ii) engorged Ixodes sp. ticks collected from dogs and cats during their inspection in veterinary clinics of the city of Poznań, west-central Poland.

Methods

Host-seeking ticks were sampled in dog walking areas localized in urban forested recreational sites of the city. We screened 1059 host-seeking and 837 engorged I. ricinus ticks removed out of 680 tick infested animals (567 dogs and 113 cats). Moreover, 31 I. hexagonus ticks (one larva, 13 nymphs and 17 females) were collected from three cats and one larva and one nympf from two dogs and one dog was infested with a single Dermacentor reticulatus female.
Borrelia species were identified by amplification and sequencing of the V4 hypervariable region of the 16S rRNA gene and the flaB gene fragments.

Results

DNA of B. miyamotoi was detected in 22 (2.1%) of the host-seeking ticks, in all developmental tick stages, and in all study areas. A similar infection prevalence (1.8%) was identified in the engorged I. ricinus ticks. Out of the infested animals, 2.2% were exposed to B. miyamotoi positive ticks. Out of the I. hexagonus ticks, three (9.1%) one female and two nymph , yielded DNA of B. miyamotoi. A single Dermacentor reticulatusfemale collected from a dog tested PCR-negative for the bacterium.

Conclusions

Our results demonstrate that the bacterium is well-established and broadly present in tick populations from different urban ecosystems of the city of Poznań. The lack of difference in mean infection prevalence between animal-derived and host-seeking I. ricinus ticks, suggests that systematic surveillance of pets, may be useful to evaluate the risk of acquiring Borrelia miyamotoi disease in urban areas. Additional studies are needed to further elucidate the role of domestic and wild carnivores in the epidemiology of B. miyamotoi which remains unknown.

Borrelia RF-group

TBRF

BMD

Ixodes ricinus

Ixodes hexagonus

Dermacentor reticulatus

Canis familiaris

Felis catus

Borrelia miyamotoi – a relapsing fever (RF)-group spirochete – is an emerging tick-borne pathogen, which affects humans and can tigger B. miyamotoi disease (BMD). The BMD causes recurrent bacteriemia with a high relapsing fever reaching up to 39°C, accompanied by flu-like symptoms, such as headache, chills, arthralgia/myalgia, and in contrast to Lyme disease (LD), an episodic erythema migrans. As the other RF borreliae, B. miyamotoi multiplies efficiently in blood, which can lead to high spirochaetemia and can be transported to any blood perfused tissue [1]. Furthermore, the bacterium was also shown to be the causative agent of meningoencephalitis in immunocompromised patients [2]. Cases of BMD, also designated as hard-tick-borne relapsing fever (HTBRF), have been reported from Russia, the United States, Europe and Japan [3, 4]. Most of the cases were described with a nonspecific clinical picture, including fever and malaise, which suggests that the disease and its causative agent seem to be underestimated [2, 5]. There are suggestions that LD endemic areas may be falsely free from B. miyamotoi and this may have impact on misdiagnosis of BMD. Therefore in such regions identification of this spirochete should be included in the current approach to the diagnosis in febrile patients without an erythema migrans rash suspected of a tick-borne infection [6]. Furthermore, BMD can be misdiagnosed as human granulocytic anaplasmosis due to Anaplasma phagocytophilum infection or human monocytic ehrlichiosis induced by Ehrlichia spp. [6, 7].

Borrelia miyamotoi was originally isolated from unfed adult Ixodes persulcatus ticks and the rodent Apodemus argenteus in Japan [8]. Phylogenetically, B. miyamotoi clusters with the tick-borne relapsing fever (TBRF) borreliae, which are primarily transmitted to vertebrate hosts by soft ticks (Argasidae) of the genus Ornithodoros [9]. Based on geographic distribution of vector and reservoir hosts, the TBRF group is genetically and ecologically distinct from the LD borreliae. The latter one comprises of at least 24 species within the Borrelia burgdorferi sensu lato complex (BSL), nine of which have been detected in European I. ricinus [10]. Borrelia miyamotoi has a global distribution in the northern hemisphere and similarly as all recognized BSL species uses the same Ixodes spp. as biological vectors [11]. The worldwide incidence of this spirochete in host-seeking Ixodes species ranges from 0.2 to 10% [12]. To date, the highest infection rates have been reported in I. pacificus (15.4%) sampled in California and in I. persulcatus (16%) in Russia [11].

Since B. miyamotoi, similarly as spirochetes from BSL group, uses tick species from the I. ricinus complex feeding on a wide range of vertebrate species, its reservoir hosts seem are believed to be primarily the same as B. burgdorferi s.l. [4]. In Europe, reservoirs for this spirochete were demonstrated among small rodents: Apodemus spp. mice and Myodes glareolus voles [13–15]. The DNA of the bacterium was also found in European hedgehogs, Eurasian red squirrels, roe deer, and passerine birds (e.g. blackbirds, robins) [1, 16]. Interestingly, domestic ruminants do not seem to eliminate the bacterium in molted I. ricinus ticks that had previously engorged on ruminants, and therefore they may not support its circulation [17].

In Europe, dogs and cats are frequently infested by I. ricinus ticks [18]. Studies on Borrelia spp. infection in dog-derived ticks showed that these animals are exposed to at least four BSL species: B. burgdorferi sensu stricto, B. afzelii, B. garinii, and B. valaisiana [10, 19, 20], which may induce canine LD [21]. Borrelia burgdorferi s.l. seropositive cats rarely show clinical signs, neither after natural nor experimental infections [22]. On the one hand, only two cases of Lyme carditis have been reported in cats in the UK [23]. On the other hand, dogs and cats are known to be susceptible to B. turicatae and B. hermsii vectored by soft ticks in the United States [24], and the new species, B. persica, has been described from companion animals in Israeli and Iran [25, 26]. Furthermore, Margos et al. [27] reported two cases of canine TBRF caused by B. hispanica in Spain. Interestingly, there is only one report on B. miyamotoi in two healthy cats in the United States [28]. However, whether dogs and cats are susceptible to this bacterium remains unknown.

The aim of our study was to assess the prevalence of B. miyamotoi in ixodid ticks collected from the vegetation, as well as from dogs and cats in urban areas of the city of Poznań, west-central Poland. Ixodes ricinus host-seeking ticks were collected within companion animal walking areas localized in urban forested recreational sites, whereas the engorged ticks were removed from animals in veterinary clinics of the city.

Study areas, tick collection

Host-seeking ticks were collected by flagging a 1 m² woolen blanket over the vegetation along the paths within five forested green areas used for recreational activities and as walking areas for dogs in the city of Poznań, from May to September 2017 and in April 2018 (Fig. 1). The five study sites were represented by: (i) two urban forests localized around Rusałka (RL) and Malta (ML) lakes, (ii) Sołacki (SP) and Citadel (CP) city parks, and (iii) Morasko Adam Mickiewicz University Campus (MOR), which includes teaching buildings adjacent to farmland and forest stands dominated mostly by Scots pine. Rusałka Lake is surrounded mainly by mixed and deciduous forests with numerous paths for strolling, cycling, and a public summer bathing. Malta Lake is the largest artificial water reservoir in Poznań and is surrounded by mixed communal forest stands. Sołacki Park with two ponds and Bogdanka Stream running through it, is covered by deciduous tree stands with large numerous lawns. Citadel Park is the largest municipal park localized in the center of the city adjacent to residential areas. Deciduous trees and lawn areas dominate with numerous promenades, large lawns and military cemeteries and remains of fortifications.

Ticks infesting dogs and cats were collected in 17 veterinary clinics in Poznań (Fig. 1; suppl. Tab. S1). This tick collection was obtained during a three-year survey: from April to October 2015, from March to November 2016, and from March to September 2017. Based on information from questionnaires regarding the travel history of the animal (with departure and return dates) outside the city at least two weeks prior to tick collection, the host-derived ticks were split into two groups: (i) resident animals (RA) and (ii) travelling animals (TA). Ticks were preserved in 96% ethanol until DNA extraction. Adult ticks were identified to species using morphological characters [29]. DNA-barcoding based on cytochrome c oxidase subunit I (COI) amplification and next generation sequencing (NGS) of the amplicons were used to identify Ixodes nymphs and larvae.

DNA extraction from ticks

All ticks were tested individually. The host-seeking ticks were subjected to DNA extraction using the ammonium hydroxide method while the engorged ticks were homogenized using a FastPrep-24 homogenizer (MP Biomedicals, USA) and were subjected to DNA extraction using a column method as previously described by Liberska et al. [30] (2021). All DNA isolates were stored at -20°C until analysis.

DNA metabarcoding of ticks

In detail, the metabarcoding method was described previously [31] including ticks [30]. In brief, the COI gene fragment was amplified using the primer pair bcdF01 (CATTTTCHACTAAYCATAARGATATTGG) [32] and bcdR06 (GGDGGRTAHACAGTYCAHCCNGT) [31] fused with Ion Torrent double-indexed adapters. PCR amplification was performed in a volume of 5 µl containing HOT FIREPol Blend Master Mix, 0.25 µM of each fused primer and 1 µl of template DNA. The amplification program included 12 min at 95°C, followed by 35 cycles of 15 s at 95°C, 30 s at 50°C and 45 s at 72°C, with a final extension step at 72°C for 5 min. PCR samples were pooled and stored at 4°C until library preparation and NGS sequencing. Negative controls from null DNA extraction and PCR reagents were amplified and sequenced together with the samples tested in this study.

Screening for Borrelia spp. DNA by nested PCR

Engorged ticks were screened for the presence of Borrelia DNA using the flaB gene amplified by nested PCR with two primer sets 132f/905r and 220f/823r [33]. First round of the PCR was prepared in a total volume of 6 µl containing Type-it Microsatellite PCR Master Mix 2x (Qiagen), 0.25 µM of each 132f (TGGTATGGGAGTTTCTGG) and 905r (TCTGTCATTGTAGCATCTTT) primer and 1 µl of template DNA. Amplification program was as follows: 5 min at 95^oC, followed by 40 cycles of 30 s at 95^oC, 45 s at 50^oC and 1 min at 72^oC, with a final extension step at 72^oC for 7 min. Second round PCR was prepared in a total volume of 10 µl containing Type-it Microsatellite PCR Master Mix, 0.2 µM of each fla220f (CAGACAACAGAGGGAAAT) and 823r (TCAAGTCTATTTTGGAAAGCACC) primer and 1 µl of the 10 times diluted first round PCR reaction. Amplification program was as follows: 5 min at 95^oC, followed by 40 cycles of 30 s at 95^oC, 45 s at 50^oC and 1 min at 72^oC, with a final extension step at 72^oC for 7 min. PCR products of the second round of amplification were diluted 2 times with water and 5 µl of the sample were analyzed by electrophoresis on a 1% agarose gel. Samples containing visible bands were purified with thermosensitive Exonuclease I and FastAP Alkaline Phosphatase (Thermo Scientific, USA). The amplicons (c.a. 500 bp) were sequenced in both directions using the 220f and 823r primers. Sequencing was performed with BigDye Terminator v3.1 on an ABI Prism 3130XL Analyser (Applied Biosystems, USA). Sequence chromatograms were checked for accuracy in FinchTV 1.4.0 (Geospiza Inc., USA) and contigs were assembled manually in GeneDoc [34]. The assembled sequences were aligned using ClustalW [35]. Obtained sequences were compared with those available in the GenBank using BLASTN [36] (https://blast.ncbi.nlm.nih.gov/) and the megablast algorithm.

Screening for Borrelia spp. DNA by 16S rRNA gene-profiling

Host-seeking ticks were screened for B. miyamotoi DNA by amplification and sequencing of the V4 hypervariable region of the 16S rRNA gene (V4 16S). This region is commonly used to screen environmental samples for bacterial taxa, and may be used to detect different Borrelia species. We used PCR primers V4F (GATCAGCAGCCGCGGTAATA) [37] and V4R (GGACTACCAGGGTATCTAA) [38] fused with indexes and Ion Torrent adapters. PCRs were done in the volume of 10 µl containing 2 µl HOT FIREPol Blend Master Mix (Solis BioDyne, Estonia), 0.25 µM of each primer, and about 1 ng of template DNA. Each sample was amplified in two technical replicates which were pooled after PCR. The PCR program was as follows: 12 min at 95°C, 30 cycles of 15 s at 95°C, 30s at 50°C, 30s at 72°C, and a final 5 min at 72°C.

Library preparation and NGS sequencing

The pooled amplicons were separated from non-specific PCR products using 2% E-Gel SizeSelect II Agarose Gels system (Invitrogen, USA), according to manufacturer’s

instructions. Library concentration and its fragment length distribution were established using

the 2200 Tape Station system (Agilent Technologies, USA) and High Sensitivity D1000

Screen Tape assay, according to manufacturer’s instructions. Clonal template amplification and sequencing were performed using the Ion Torrent One Touch System II and the Ion PGM Hi-Q View OT2 Kit. Sequencing was carried out using the Hi-Q View Sequencing Kit and Ion PGM system on Ion 314 and Ion 318 chips. All steps of the NGS sequencing were performed according to the manufacturer’s instructions (Thermo Fisher Scientific). Libraries were sequenced to get at least 500 reads per sample for COI gene fragment and 50,000 for V4 16S.

NGS data analysis

Raw sequence data were pre-filtered by Ion Torrent Suite software version 5.10.1 (Life

Technologies, USA) to remove polyclonal and low quality sequences. Further bioinformatic

analysis was conducted using fastq data and custom workflow. Sequence reads shorter than 180-bp were removed from the dataset. Quality filtered sequences were separated into individual combinations of indexes in Geneious R11.1.5 (Biomatters Ltd.). Next, the sequences were trimmed at 5’ and 3’ ends to exclude PCR primers. Operational taxonomic unit (OTU) clustering was done in USEARCH version 11.0.667 [39]. The OTU consensus sequences were compared to GenBank using optimized for highly similar sequences (megablast algorithm) [40] with 100% similarity to determine Borrelia species, and with 97% identity threshold to identify immature Ixodes tick species.

Statistical analysis

Data analysis was carried out using STATISTICA software version 6.0 (StatSoft Inc., Tulsa, OK, USA). Rates of infection were analysed by use of Chi-squared test χ2 and Fisher exact test. A p < 0.05 was considered statistically significant.

Phylogenetic analysis

For phylogenetic analysis we used 19 sequences representing V4 16S of all Borreliaceae species that have been published to date in GenBank, two different types of V4 16S sequences found in this study and Spirochaeta lutea sequence used to root the tree (Table S2). Sequences were aligned in MUSCLE v. 3.8.425 and a phylogenetic tree was built using FastTree 2.1.11 as implemented in Geneious Prime 2022.1.1 (Biomatters Ltd.). The tree was edited in Mega7 [41] and Corel Draw v. X5.

Collection and identification of ticks

A total of 1059 host-seeking I. ricinus ticks (30 larvae, 460 nymphs, 289 females, and 280 males) were collected from five urban green areas (Table 1). Ticks were the most abundant in two forested recreational areas localized at lakes (RL and ML), and accounted for 84% of the total tick number sampled in this study.

In total, 837 engorged I. ricinus ticks (831 females and 6 nymphs) were removed from 680 tick-infested companion animals (567 dogs and 113 cats) in the 17 veterinary clinics (Table 2). Females distinctly prevailed over nymphs (99.3% vs. 0.7% of total tick numbers, respectively) and were partially engorged. Furthermore, 14 non-parasitic males were collected. The dogs and cats hosted comparable numbers of attached ticks (1.2 and 1.3 per animal, respectively), and most animals were infested with only one tick at the time of examination. Moreover, 31 I. hexagonus ticks (one larva, 13 nymphs and 17 females) were collected from three cats. Two dogs hosted one larva and one nymph of I. hexagonus and one dog was infested with a single Dermacentor reticulatus female. Each of the three cats and the two dogs infested with I. hexagonus was concurrently parasitized by a single I. ricinus female.

Prevalence of B. miyamotoi in host-seeking ticks

Borrelia miyamotoi DNA was detected in 22 (2.1%) of 1059 host-seeking I. ricinus ticks. The bacterium was found in all developmental tick stages and in all study areas (Table 1). The prevalence values were comparable for female and male ticks (1.0%; 3/289 and 1.4%; 4/280,respectively). Nymphs (2.8%; 13/460) were more frequently infected compared to adult ticks (1.2%; 7/569), however this difference was statistically insignificant (χ2 test, P = 0.061).

In two forested recreational areas localized at lakes (RL and ML), the bacterium was identified in nymphs, females and males. In the latter area, an infection rate of 12.5% (2/16) was also confirmed in larvae. In two city parks, CP and SP, B. miyamotoi was found only in I. ricinus males (2.4% and 7.1%, respectively), whereas in MOR Campus, only nymphs (5.9%) proved to be infected with the bacterium. Comparable infection prevalences were found in ticks collected in forested areas situated at lakes (RL and ML) and in MOR campus (2.2%, 2.0% and 2.4%, respectively). Similar infection rates were also observed for ticks from two strictly city parks: CP and SP (1.4 and 1.7%, respectively).

Table 1

*Borrelia miyamotoi* positive host-seeking *Ixodes ricinus* ticks collected in urban recreational areas in Poznań, Poland.
Sampling area	No. ticks infected/tested (%)
Sampling area	Larvae		Nymphs	Females	Males	Total
Rusałka Lake (RL)		0/1	11/313 (3.5)	2/170 (1.2)	1/153 (0.7)	14/637 (2.2)
Malta Lake (MAL)		2/16 (12.5)	1/109 (0.9)	1/65 (1.5)	1/63 (1.6)	5/253 (2.0)
Citadel Park (CP)0/40/241/41 (2.4)1/69 (1.4)			0/4	0/24	1/41 (2.4)	1/69 (1.4)
Sołacki Park (SP)		0/13	0/17	0/15	1/14 (7.1)	1/59 (1.7)
Morasko Campus (MOR)			1/17 (5.9)	0/15	0/9	1/41 (2.4)
Total		2/30 (6.7)	13/460 (2.8)	3/289 (1.0)	4/280 (1.4)	22/1059 (2.1)

Prevalence of B. miyamotoi in ticks removed from dogs and cats

Borrelia miyamotoi DNA was identified in 15 (1.8%) of the 831 engorged I. ricinus ticks, of which all were females. None of the six nymphs yielded the bacterium (Table 2). These females were removed from 13 dogs and two cats examined in seven veterinary clinics. The proportion of cats and dogs exposed to infected ticks varied within the clinics (Table 2). There was no statistically significant difference in mean infection prevalence between engorged and host-seeking I. ricinus ticks (1.8% versus 2.1%, χ2 test, P = 0.656).

Out of the 31 I. hexagonus cat-derived ticks, two (6.5%) including one female and one nymph, yielded DNA of B. miyamotoi. The bacterium was also found in one I. hexagonus nymph removed from a dog. A single Dermacentor reticulatus female collected from a dog tested PCR-negative for the bacterium.

Based on the questionnaire, the risk of exposure to infected ticks among dogs which travelled outside of the city of Poznań, was slightly higher compared to resident animals that did not travel (3.3% vs. 1.4%, χ2 test, P = 0.106), however this difference was statistically insignificant. The similar trend was noted among travelling and resident cats (3.6% vs. 0.8%, χ2 test, P = 0.250; Table S3).

Table 2
*Borrelia miyamotoi* positive engorged *I. ricinus* ticks collected from 17 veterinary clinics localized in Poznań.
Clinics	Infested dogs			Infested cats			Total ticks
	N	Ticks infected/tested (%)		N	Ticks infected/tested (%)
	N	Nymphs	Females	N	Nymphs	Females
1	23		23	15		18	41
2	10		21				21
3	72	0/2	1/76 (1.3)	5		1/7 (14.3)	2/85 (2.3)
4	12	0/1	12				12
5	24		23	1		1	24
6	39		1/39 (2.6)	5		5	1/44 (2.3)
7	11		18	2		2	20
8	31		32	3		3	35
9	40		3/56 (3.6)	5		5	3/61 (4.9)
10	3		1/3 (33.3)	4		7	1/10 (10.0)
11	104		4/138 (2.9)	9		10	4/148 (2.7)
12	43		1/53 (1.9)	6		1/6 (16.7)	2/59 (3.4)
13	26		26	13		13	39
14	30		38	12	0/2	24	40
15	25		30	3		3	33
16	30		39	11		13	52
17	44	0/1	2/55 (3.6)	19		32	2/87 (2.3)
Total	567	0/4	13/682 (1.9)	113	0/2	2/149 (1.3)	15/837 (1.8)

Names of veterinary clinics: (1) Jagiełły, (2) Piątkowska, (3) Wichrowe Wzgórze, (4) Batorego, (5) Chwiałkowskiego, (6) Bułgarska, (7) Marcelińska, (8) Armii Krajowej, (9) Jagiellońskie, (10) Św. Antoniego, (11) Rzeczypospolitej, (12) Bnińska, (13) Katowicka, (14) Lecha, (15) Orła Białego, (16) Chwaliszewo, (17) Księcia Mieszka I (Fig. 1 and Tab. S1)

Diversity of B. miyamotoi V4 16S and flaB sequences

Among 22 B. miyamotoi V4 16S sequences identified in PCR-positive host-seeking ticks, two variants differing in one nucleotide position within the 290 bp sequence fragment were identified. The prevailing sequence variant, found in 95% (21/22) of the B. miyamotoi-positive ticks demonstrated 100% of nucleotide identities to B. miyamotoi found in I. ricinus eggs from the Czech Republic, e.g., GenBank CP046389. The second variant of the V4 16S sequence (GenBank MZ918969) was found only in I. ricinus larva collected around ML lake.

Borrelia miyamotoi-specific amplicons detected from companion animals displayed the same variant of flaB gene presenting 100% of nucleotide identities to B. miyamotoi isolates from ticks feeding on roe deer from Poland, e.g., GenBank FJ874925.

Phylogenetic analysis of V4 16S

Two V4 16S sequence variants found in this study were aligned with 19 sequences representing 19 different Borrelia species (Table S2, Fig. 2). Results of the phylogenetic analysis clearly show that V4 16S sequence allows the differentiation of most of the bacterial species (14/19) in both the LD- and RF-group spirochetes. Only B. bissettiae and B. burgdorferi sensu stricto in the LD-group and B. crocidurae, B. duttonii and B. recurrentis in the RF-group are undifferentiated in this marker. However, this problem does not concern B. miyamotoi. Both sequence variants found in this study formed one well-supported clade with B. miyamotoi found in I. persulcatus collected from Apodemus argenteus in Japan (GenBank CP004217).

The availability of the sequences found in this study

Forty-three partial B. miyamotoi sequences were generated in this study and deposited in GenBank (Table S4). The V4 16S rRNA gene sequences (n = 22) obtained from host-seeking I. ricinus ticks (2 larvae, 13 nymphs, 3 females, and 4 males) were deposited under the following accession numbers: MZ918966 - MZ918987. The flaB gene sequences (n = 21) identified in feeding females of Ixodes ticks were listed as follows: ON000073-ON000074, ON000076-ON000081, ON000084- ON000090 (I. ricinus from dogs); ON000075, ON000082 (I. ricinus from cats), ON000091 (I. hexagonus from a cat).

In Europe, the primary biological vector of B. miyamotoi, the newly confirmed human pathogenic tick-borne relapsing fever spirochete, is the most widespread and abundant I. ricinus. In the present study, we provide evidence of B. miyamotoi infections in two groups of I. ricinus ticks occurring in urban areas of the city of Poznań, west-central Poland: (i) host-seeking ticks collected in forested recreational sites, and (ii) engorged ticks obtained from dogs and cats in veterinary clinics of the city. The mean infection prevalence of the bacterium found in host-seeking ticks studied in urban areas of the city of Poznań was 2.1% (range: from 1.4 to 2.4%). This level corresponds with infection rates described e.g. in Netherlands, Switzerland, Germany and Latvia (2.5, 2.5, 2.1 and 1.1% respectively) [42–45]. In Europe, the overall prevalence of B. miyamotoi in host-seeking I. ricinus ticks varies from 0.16% in Portugal [46] to 4.8% in Hungary [47] and is usually about ten times lower compared to BSL spirochetes [11]. The infection prevalence determined in our study was comparable to infection rates reported from two other Polish urban agglomerations: the city of Warsaw (1.3%) in central Poland [48] and the city of Olsztyn (3.5%) in north-eastern Poland [49]. In Poland, the highest B. miyamotoi prevalences (6.4–8.4%) were noted in suburban recreational areas of the city of Białystok in northeastern Poland [50]. However, so far, no endemic or risk sites in Poland have been identified for B. miyamotoi. A recent Polish study by Gryczyńska et al. [15] conducted in the Warsaw agglomeration, highlights the contribution of two Apodemus mice species: A. flavicolis and A. agrarius to the circulation of B. miyamotoi. The authors observed that rodents captured in suburban forests, where the anthropogenic disturbances are relatively small, yielded the bacterium more frequently compared to animals examined in parks situated strictly in the city center (6.7 versus 4.3%). Ecological differences in urban habitats could explain our results regarding a higher mean infection prevalence observed in ticks collected in three urban forests (Rusałka lake, Malta lake and MOR University Campus) in comparison with ticks derived from Sołacki and Citadel city parks (2.1% versus 1.6%), even though, we did not find any statistically significant differences. In the case of forest stands localized at Rusałka lake, it has been shown, that both Apodemus species act as significant reservoir hosts to BSL spirochetes [51].

Our finding, that 6.7% (2/30) of host-seeking I. ricinus larvae yielded the bacterium, confirms the well-documented strategy of transovarial (vertical) transmission from infected tick females to their offspring, which is used by most of the relapsing fever Borreliae including B. miyamotoi [52]. Furthermore, this finding highlights the differences in the transmission dynamics of BSL group and RF borreliae. The spirochaetes from the first group are believed to be rather inefficiently transmitted transovarially [53], whereas species belonging to the second group (e.g., B. hermsi, B. turicata, B. crocidurae, B. duttoni) can be maintained by this type of transmission for as many as five generations [54]. Therefore, although I. ricinus larvae are responsible only for 1.3 to 4.2% of human tick bites [55], they may pose a potential risk of acquiring B. miyamotoi infections.

Most engorged I. ricinus ticks removed from pets were adult females, which is consistent with previous studies [10, 18]. Out of the 680 I. ricinus infested animals (567 dogs and 113 cats), 2.2% were exposed to B. miyamotoi positive ticks. A similar proportion of dogs and cats exposed to B. miyamotoi infected I. scapularis ticks was observed during a four-year study conducted in Canada (≈ 1.2%, range: 0.3–7.2%, and ≈ 1.3%, range: 0.2–8.0%, respectively) [56]. The overall infection prevalence in the engorged ticks (1.8%) tested in our study, was comparable to I. ricinus ticks removed from dogs in Germany (1.4%) and slightly higher than reported in dog-derived ticks in Latvia (1.0%) [57, 58]. We did not find any differences in mean infection prevalence between engorged and host-seeking I. ricinus ticks (1.8% versus 2.1%). This finding may indicate that the risk of exposure of dogs or cats to B. miyamotoi, is associated with infection rates among local populations of host-seeking I. ricinus, especially female ticks, which prevail on companion animals. Therefore in our opinion, microbiological analysis of dog- or cat-derived ticks could be also helpful to estimate the human risk for exposure to the bacterium. We identified B. miyamotoi DNA in 9.0% of the 33 engorged I. hexagonus ticks, which infested mainly cats (n = 31) and occasionally dogs (n = 2). This infection rate was higher compared to dog-derived I. hexagonus ticks (2.0%) tested in Germany [57] and to ticks removed from European hedgehogs (1.5%) examined in Belgium [59]. Although the nidicolous I. hexagonus tick associated primarily with hedgehogs, has been demonstrated to act as the competent vector for BSL spirochetes [60], there is still no data about its involvement in the enzootic cycle of B. miyamotoi. We failed to detect the bacterium in a single dog-derived Dermacentor reticulatus female tick. To date, the only evidence of B. miyamotoi infection in host-seeking D. reticulatus ticks (0.5%; 1/2000) was reported from Berlin, Germany [61]. Presumably this tick species, which supports transmission of Babesia canis [62], seems to be incompetent vector in enzootic cycles of B. miyamotoi.

We observed that dogs and cats which travelled outside of the city of Poznań (prior to tick collection), exhibited slightly higher the risk of exposure to B. miyamotoi infected ticks compared to resident dogs and cats, that did not travel (3.3 and 3.6 versus 1.4 and 0.8%, respectively), however these differences were statistically insignificant. According to Duplaix et al. (2021) [56], travelling of dogs and cats outside the province of Quebec, Canada, was a risk factor for exposure to I. scapularis ticks infected with B. burgdorferi spirochetes compared to resident animals that did not travel outside their municipality of residence. However, they failed to identify such correlation for B. miyamotoi positive ticks.

In contrast to BSL spirochetes, B. miyamotoi has not been so far identified as a bacterial agent causing illness in dogs or cats, and is poorly documented in veterinary medicine. Furthermore, there are no reports of either suspect or confirmation of HTBRF infections in other domestic animals. There is also no information on the involvement of wild carnivore species in transmission cycles of B. miyamotoi. To date, only report by documented the bacterium in one I. ricinus female collected from a raccoon dog [63]. Limitation of epidemiological information can partially result from similarity in haematological and clinical symptoms of TBRF diseases and LD [64].

Detection of B. miyamotoi DNA in host-seeking I. ricinus ticks, in all developmental tick stages, and in all study areas, demonstrates that the bacterium is well-established and broadly present in tick populations from different urban ecosystems of the city of Poznań. The lack of difference in mean infection prevalence between animal-derived and host-seeking I. ricinus ticks, suggests that systematic surveillance of pets may be useful to evaluate the risk of acquiring BMD in urban areas. Therefore, veterinarians and physicians need to be aware of this potential threat to the health of pets and their owners.

In our opinion, knowledge about B. miyamotoi reservoir species including domestic and wild carnivores species, needs to be completed to understand enzootic transmission cycles of the bacterium in urban environments.

a relapsing fever

BMD

B. miyamotoi disease

Lyme disease

HTBRF

hard-tick-borne relapsing fever

TBRF

tick-borne relapsing fever

BSL

Borrelia burgdorferi sensu lato complex

urban forest localized around Rusałka lake

urban forest localized around Malta lake

Sołacki City Park

Citadel City Park

MOR

Morasko Adam Mickiewicz University Campus

the ticks from resident animals

the ticks from travelling animals

NGS

next generation sequencing, COI:Cytochrome c oxidase subunit I gene

flaB

partial DNA sequences of flaB gene, encoding flagellin

V4 16S

V4 hypervariable region of the 16S rRNA gene

OTU

operational taxonomic unit.

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Availability of data and materials

All data generated or analyzed during this study are included in this published article [and its supplementary information files]

Sequences generated in this study are available in GenBank under accession nos. ON000073- ON000093 and MZ918966-MZ918987. Additional details are available in Additional file: Table S1. List of veterinary clinics included in this study, Table S2. List of V4 16S sequences of Borreliaceae used in the phylogenetic analysis, Table S3. Prevalence of Borrelia miyamotoi in dog- and cat-derived I. ricinus ticks depending on host travel history (resident versus travelling animals) and Table S4. Borrelia miyamotoi sequences generated in this study and deposited in GenBank; V4 sequence alignment and the remaining data that support the findings of this study are available from the corresponding author upon request.

Competing interests
The authors declare that they have no competing interests.

Funding

This work was supported by the project Passport to the Future -Interdisciplinary doctoral studies at the Faculty of Biology, AMU,POWR.03.02.00-00-I006/17 (JL)

Authors' contributions

JL: Conceptualization, Investigation, Data curation, Formal analysis, Writing – original draft, Writing – review & editing, Funding acquisition. JM: Conceptualization, Writing – review & editing. MD: Methodology, Validation, Supervision, Writing – review & editing.
All authors read and approved the final manuscript.

Acknowledgements
We would like to thank Urszula Sobczyńska, Łukasz Broda, Weronika Pawlik and Aneta Łyś, Adam Mickiewicz University in Poznan, for their assistance in collecting ticks from urban ecosystems. We would like to thank all the veterinary clinics involved in the study: Centrum Zdrowia Małych Zwierząt M. Majka, R. Starczewski s.c., Gabinet Weterynaryjny Katarzyna Gryglewska, Gabinet Weterynaryjny lek. wet. Dariusz Filipiński, Gabinet Weterynaryjny Marcin Konieczny, Gabinet weterynaryjny - Piotr Winiecki, Klinika Weterynaryjna Juszczak & Gorzelańczyk, Praktyka Weterynaryjna A.Golec M.Rybski, Gabinet Weterynaryjny PLUTO VETlek wet Krzysztof Kaniewski, Zwierzak Gabinet Weterynaryjny A. Adamska, AMICUS Gabinet Weterynaryjny Grzegorz Macioch, Usługi Weterynaryjne Jakub Golec, Przychodnia Weterynaryjna Na Polance Katarzyna Marciniak, Specjalistyczny Gabinet Weterynaryjny lek. wet. Żaneta Sokołowska, PRZYCHODNIA WETERYNARYJNA lek. wet. Adam Łowczak, Przychodnia Weterynaryjna Kociak lek. wet. Sylwia Łata, Klinika Weterynaryjna dr. Grzegorza Wąsiatycza. This research was supported in part by PLGrid Infrastructure.

Authors' information

Authors and Affiliations

Molecular Biology Techniques Laboratory, Faculty of Biology, Adam Mickiewicz University Poznan, Poland
Justyna Liberska, Mirosława Dabert

Department of Animal Morphology, Faculty of Biology, Adam Mickiewicz University, Poznań, Poland
Jerzy Michalik

Talagrand-Reboul E, Boyer P H, Bergström S, Vial, L, Boulanger N. Relapsing fevers: neglected tick-borne diseases. Front Cell Infect Microbiol. 2018;8:98.
Hovius JW, de Wever B, Sohne M, Brouwer MC, Coumou J, Wagemakers A, et al. A case of meningoencephalitis by the relapsing fever spirochaete Borrelia miyamotoi in Europe. Lancet. 2013;382:658.
Platonov AE, Karan LS, Kolyasnikova NM, Makhneva NA, Toporkova MG, Maleev VV, et al. Humans infected with relapsing fever spirochete Borrelia miyamotoi, Russia. Emerg Infect Dis. 2011;17:1816.
Krause PJ, Fish D, Narasimhan S, Barbour A.G. Borrelia miyamotoi infection in nature and in humans. CMI. 2015;21:631–639.
Wagemakers A, Staarink PJ, Sprong H, Hovius JW. Borrelia miyamotoi: a widespread tick-borne relapsing fever spirochete. Trends Parasitol. 2015;31:260–269.
Telford III SR, Goethert HK, Molloy PJ, Berardi VP, Chowdri HR, Gugliotta J L, et al. Borrelia miyamotoi disease: neither Lyme disease nor relapsing fever. Clin Lab Med. 2015;35:867–882.
Chowdri HR, Gugliotta JL,. Berardi VP, Goethert HK, Molloy PJ, Sterling SL, et al. Borrelia miyamotoi infection presenting as human granulocytic anaplasmosis: a case report Ann. Intern. Med. 2013;159:21–27.
Fukunaga M, Takahashi Y, Tsuruta Y, Matsushita O, Ralph D, McClelland M, et al. Genetic and phenotypic analysis of Borrelia miyamotoi sp. nov., isolated from the ixodid tick Ixodes persulcatus, the vector for Lyme disease in Japan. Int J Syst Evol Microbiol. 1995; 45:804–810.
Schwan TG, Piesman J. Vector interactions and molecular adaptations of Lyme disease and relapsing fever spirochetes associated with transmission by ticks. Emerg Infect Dis. 2002;8:115.
Michalski MM, Kubiak K, Szczotko M, Chajęcka M, Dmitryjuk M. Molecular detection of Borrelia burgdorferi sensu lato and Anaplasma phagocytophilum in ticks collected from dogs in urban areas of North-Eastern Poland. Pathogens. 2020;9:455.
Cutler S, Vayssier-Taussat M, Estrada-Peña A, Potkonjak A, Mihalca AD, Zeller H. A new Borrelia on the block: Borrelia miyamotoi - a human health risk? Eurosurveillance. 2019;24:1800170.
Kubiak K., Szczotko M., Dmitryjuk M. Borrelia miyamotoi - An Emerging Human Tick-Borne Pathogen in Europe. Microorganisms. 2021;9:154.
Burri C, Schumann O, Schumann C, Gern L. Are Apodemus spp. mice and Myodes glareolus reservoirs for Borrelia miyamotoi, Candidatus Neoehrlichia mikurensis, Rickettsia helvetica, R. monacensis and Anaplasma phagocytophilum? Ticks Tick Borne Dis. 2014;5:245–251.
Cosson JF, Michelet L, Chotte J, Le Naour E, Cote M, Devillers E, et al. Genetic characterization of the human relapsing fever spirochete Borrelia miyamotoi in vectors and animal reservoirs of Lyme disease spirochetes in France. Parasit Vectors. 2014;7:1–5.
Gryczyńska A, Sokół M, Gortat T, Kowalec M. Borrelia miyamotoi infection in Apodemus spp. mice populating an urban habitat (Warsaw, Poland). Int J Parasitol Parasites Wildl. 2021;14:138–140.
Majerová K, Hönig V, Houda M, Papežík P, Fonville M, Sprong H, Rudenko H, et al. Hedgehogs, squirrels, and blackbirds as sentinel hosts for active surveillance of Borrelia miyamotoi and Borrelia burgdorferi complex in urban and rural environments. Microorganisms. 2020;8:1908.
Richter D, Matuschka FR. Elimination of Lyme disease spirochetes from ticks feeding on domestic ruminants. Appl Environ Microbiol. 2010;76:7650–7652.
Król N, Kiewra D, Szymanowski M, Lonc E. The role of domestic dogs and cats in the zoonotic cycles of ticks and pathogens. Preliminary studies in the Wroclaw Agglomeration (SW Poland). Vet. Parasitol. 2015;214:208–212.
Hovius KE, Stark LA, Bleumink-Pluym NM, van de Pol I, Verbeek-de Kruif N, Rijpkema SG. Presence and distribution of Borrelia burgdorferi sensu lato species in internal organs and skin of naturally infected symptomatic and asymptomatic dogs, as detected by polymerase chain reaction. Vet Q. 1999;21:54–58.
Skotarczak B, Wodecka B. Identification of Borrelia burgdorferi genospecies inducing Lyme disease in dogs from Poland. Acta Vet Hun. 2005;53:12–21.
Skotarczak B. The role of companion animals in the environmental circulation of tick-borne bacterial pathogens. Ann Agric Environ Med. 2018;25:473–480.
Littman MP, Gerber B, Goldstein RE, Labato MA, Lappin MR, Moore GE. ACVIM consensus update on Lyme borreliosis in dogs and cats. J Vet Intern Med. 2018;32:887–903.
Tørnqvist-Johnsen C, Dickson SA, Rolph K, Palermo V, Hodgkiss-Geere H, Gilmore P. First report of Lyme borreliosis leading to cardiac bradydysrhythmia in two cats. JFMS Open Rep. 2020;6:2055116919898292.
Kelly AL, Raffel SJ, Fischer RJ, Bellinghausen M, Stevenson C., Schwan TG. First isolation of the relapsing fever spirochete, Borrelia hermsii, from a domestic dog. Ticks Tick Borne Dis. 2014;5:95–99.
Baneth G, Nachum-Biala Y, Halperin T, Hershko Y, Kleinerman G, Anug Y. Borrelia persica infection in dogs and cats: clinical manifestations, clinicopathological findings and genetic characterization. Parasit Vectors. 2016;9:244.
Shirani D, Rakhshanpoor A, Cutler SJ, Ghazinezhad B, Naddaf SR. A case of canine borreliosis in Iran caused by Borrelia persica. Ticks Tick Borne Dis. 2016;7:424–426.
Margos G, Fingerle V, Cutler S, Gofton A, Stevenson B, Estrada-Peña A. Controversies in bacterial taxonomy: The example of the genus Borrelia. Ticks Tick Borne Dis. 2020;11:101335.
Shannon AB, Rucinsky R, Gaff HD, Brinkerhoff RJ. Borrelia miyamotoi, other vector-borne agents in cat blood and ticks in Eastern Maryland. EcoHealth. 2017;14:816–820.
Siuda K. 1993. Kleszcze (Acari: Ixodida) Polski. II. Systematyka i rozmieszczenie. Monografie Parazytologiczne. vol. 12. Warsaw: Polish Parasitological Society; 1993.
Liberska J, Michalik J, Pers-Kamczyc E, Wierzbicka A, Lane RS, Rączka G. Prevalence of Babesia canis DNA in Ixodes ricinus ticks collected in forest and urban ecosystems in west-central Poland. Ticks Tick Borne Dis. 2021;12:101786.
Trzebny A, Slodkowicz-Kowalska A, Becnel J J, Sanscrainte N, Dabert M. A new method of metabarcoding Microsporidia and their hosts reveals high levels of microsporidian infections in mosquitoes (Culicidae). Mol Ecol Resour. 2020;20:1486–1504.
Dabert M, Witalinski W, Kazmierski A, Olszanowski Z, Dabert J. Molecular phylogeny of acariform mites (Acari, Arachnida): strong conflict between phylogenetic signal and long-branch attraction artifacts. Mol Phylogenet Evol. 2010;56:222–241.
Wodecka B, Leońska A, Skotarczak B. A comparative analysis of molecular markers for the detection and identification of Borrelia spirochetes in Ixodes ricinus. J Med Microbiol. 2010;59:309–314.
Nicholas KB, Nicholas HB. Jr. GeneDoc: A Tool for editing and annotating multiple sequence alignments. Pittsburgh Supercomputing Center’s National Resource for Biomedical Supercomputing. 1997.
Larkin MA, Blackshields G, Brown NP, Chenna R, Mcgettigan PA, McWilliam H, et al. Clustal W and Clustal X version 2.0. Bioinformatics. 2007;23:2947–2948.
Zhang Z, Schwartz S, Wagner L, Miller W, 2000. A greedy algorithm for aligning DNA sequences. J. Comput. Biol. 2000;7:203–214.
Glowska E, Filutowska ZK, Dabert M, Gerth M. Microbial composition of enigmatic bird parasites: Wolbachia and Spiroplasma are the most important bacterial associates of quill mites (Acariformes: Syringophilidae). Microbiology Open. 2020;9:964.
Therese KL, Anand AR, Madhavan HN. Polymerase chain reaction in the diagnosis of uveitis. Br J Ophthalmol. 1998;82:1078–1082.
Edgar RC. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 2010;19:2460–2461.
Morgulis A, Coulouris G, Raytselis Y, Madden TL, Agarwala R, Schäffer AA. Database indexing for production MegaBLAST searches. Bioinformatics. 2008;15:1757–64.
Kumar S, Stecher G, Tamura K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Molecular Biology and Evolution. 2016;33: 1870–1874.
Wagemakers A, Jahfari S, de Wever B, Spanjaard L, Starink MV, de Vries HJC, et al. Borrelia miyamotoi in vectors and hosts in The Netherlands. Ticks Tick Borne Dis. 2017;8:370–374.
Oechslin CP, Heutschi D, Lenz N, Tischhauser W, Péter O, Rai O, et al. Prevalence of tick-borne pathogens in questing Ixodes ricinus ticks in urban and suburban areas of Switzerland. Parasites Vectors. 2017;10:558.
Blazejak K, Raulf MK, Janecek E, Jordan D, Fingerle V, Strube C. Shifts in Borrelia burgdorferi (s.l.) geno-species infections in Ixodes ricinus over a 10-year surveillance period in the city of Hanover (Germany) and Borrelia miyamotoi-specific Reverse Line Blot detection. Parasites Vectors. 2018;11:304.
Capligina V, Seleznova M, Akopjana S, Freimane L, Lazovska M, Krumins R, et al. Large-scale countrywide screening for tick-borne pathogens in field-collected ticks in Latvia during 2017–2019. Parasit Vectors. 2020;14:51.
Nunes M, Parreira R, Lopes N, Maia C, Carreira T, Sousa C. et al. Molecular Identification of Borrelia miyamotoi in Ixodes ricinus from Portugal. Vector Borne Zoonotic Dis. 2015;15:515–7.
Szekeres S, Coipan EC, Rigó K, Majoros G, Jahfari S, Sprong H. et al. Eco-epidemiology of Borrelia miyamotoi and Lyme borreliosis spirochetes in a popular hunting and recreational forest area in Hungary. Parasit Vectors. 2015;8:309.
Kowalec M, Szewczyk T, Welc-Falȩciak R, Edward Siński E, Karbowiak G, Bajer A. Ticks and the city—are there any differences between city parks and natural forests in terms of tick abundance and prevalence of spirochaetes? Parasites Vectors. 2017;10:573
Kubiak K, Dziekońska-Rynko J, Szymańska H, Kubiak D, Dmitryjuk M, Dzika E. (2019) Questing Ixodes ricinus (Acari, Ixodidae) as a vector of Borrelia burgdorferi sensu lato and Borrelia miyamotoi in an urban area of north-eastern Poland. Exp. Appl. Acarol. 2019;78:113–126.
Grochowska A, Dunaj-Małyszko J, Pancewicz S, Czupryna P, Milewski R, Majewski P, et al. Prevalence of tick-borne pathogens in questing Ixodes ricinus and Dermacentor reticulatus ticks collected from recreational areas in northeastern Poland with analysis of environmental factors. Microorganisms. 2021;9:154.
Michalik J, Hofman T, Buczek A, Skoracki M, Sikora S. 2003. Borrelia burgdorferi s.l. in Ixodes ricinus (Acari: Ixodidae) ticks collected from vegetation and small rodents in recreational areas of the city of Poznań. J. Med. Entomol. 2003;40:690–697.
Barbour AG, Bunikis J, Travinsky B, Hoen AG, Diuk-Wasser MA, Fish D, et al. Niche partitioning of Borrelia burgdorferi and Borrelia miyamotoi in the same tick vector and mammalian reservoir species. Am J Trop Med Hyg. 2009;81:1120–31.
Rollend L, Fish D., Childs JE. Transovarial transmission of Borrelia spirochetes by Ixodes scapularis: a summary of the literature and recent observations. Ticks Tick Borne Dis. 2013;4:46–51.
Burgdorfer W, Varma MGR. Trans-stadial and transovarial development of disease agents in arthropods. Ann Rev Entomol. 1967;12:347–376.
van Duijvendijk G, Coipan C, Wagemakers A, Fonville M, Ersöz J, Oei A, et al. Larvae of Ixodes ricinus transmit Borrelia afzelii and B. miyamotoi to vertebrate hosts. Parasit Vectors. 2016;9:97.
Duplaix L, Wagner V, Gasmi S, Lindsay LR, Dibernardo A, Thivierge K, et al. Exposure to tick-borne pathogens in cats and dogs infested with Ixodes scapularis in Quebec: An 8-Year Surveillance Study. Front Vet Sci. 2021;15:696815.
Schreiber C, Krücken J, Beck S, Maaz D, Pachnicke S, Krieger K, et al. Pathogens in ticks collected from dogs in Berlin/Brandenburg, Germany. Parasit Vectors. 2014;7:535.
Namina A, Capligina V, Seleznova M, Krumins R, Aleinikova D, Kivrane A, et al. Tick-borne pathogens in ticks collected from dogs, Latvia, 2011–2016. BMC Vet Res. 2019;15:398.
Jahfari S, Ruyts SC, Frazer-Mendelewska E, Jaarsma R, Verheyen K, Sprong H. Melting pot of tick-borne zoonoses: The European hedgehog contributes to the maintenance of various tick-borne diseases in natural cycles urban and suburban areas. Parasit Vectors. 2017;10:134
Gern L, Toutoungi LN, Hu CM, Aeschlimann A. (1991) Ixodes (Pholeoixodes) hexagonus, an efficient vector of Borrelia burgdorferi in the laboratory. Med Vet Entomol. 1991;5:431–5.
Kohn M, Krücken J, McKay-Demeler J, Pachnicke S., Krieger K, Samson-Himmelstjerna G. Dermacentor reticulatus in Berlin/Brandenburg (Germany): Activity patterns and associated pathogens. Ticks Tick Borne Dis. 2019;10:191–206.
Dwużnik-Szarek D, Mierzejewska EJ, Rodo A, Goździk K, Behnke-Borowczyk J, Kiewra D, et al. Monitoring the expansion of Dermacentor reticulatus and occurrence of canine babesiosis in Poland in 2016–2018. Parasit Vectors. 2021;14:267.
Wodecka B, Michalik J, Lane RS, Nowak-Chmura M, Wierzbicka A. Differential associations of Borrelia species with European badgers (Meles meles) and raccoon dogs (Nyctereutes procyonoides) in western Poland. Ticks Tick. Borne. Dis. 2016;7:1010–101.
Piccione J, Levine GJ, Duff CA, Kuhlman GM, Scott KD, Esteve-Gassent MD. Tick‐borne relapsing fever in dogs. J Vet Intern Med. 2016;30:1222–1228.

No competing interests reported.

TableS1S4.docx

Download PDF

Journal Publication

published 30 Jun, 2023

Read the published version in Ticks and Tick-borne Diseases →

Version 1

posted

You are reading this latest preprint version

Exposure of dogs and cats to Borrelia miyamotoi infected Ixodes ricinus ticks in urban areas of the city of Poznań, west-central Poland

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials And Methods

Study areas, tick collection

DNA extraction from ticks

DNA metabarcoding of ticks

Screening for Borrelia spp. DNA by nested PCR

Library preparation and NGS sequencing

NGS data analysis

Statistical analysis

Phylogenetic analysis

Results

Collection and identification of ticks

Diversity of B. miyamotoi V4 16S and flaB sequences

Phylogenetic analysis of V4 16S

The availability of the sequences found in this study

Discussion

Conclusion

Abbreviations

Declarations

Ethics approval and consent to participate

Availability of data and materials

Funding

Authors' contributions

Authors' information

Authors and Affiliations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1