6.1 Bioinformatics analysis of G4
We refer to a prior article for G4 predictions [4]. There are five PQS (Putative G-Quadruplex Sequences) types to be predicted: 1) G3+L1–7; 2) G3+L1–12; 3) G2L1–12; 4) G3+L8–12; and 5) G2+L1–12. In researching of existing literature, there are several methods for predicting G-Quadruplex sequence, including regular expression matching, scoring, sliding windows, and scoring and machine learning. We used the most classical regular expression [9].
The normal human genome was selected as the reference genome (marked as ref, https://www.ncbi.nlm.nih.gov/genome/guide/human/) and the sequence of cell line SW480 of CRC (marked as mut) was obtained from the deepmap database of Broad Institute (https://depmap.org/portal/). The mutation (including SNP adn INDEL) position of SW480 cells was obtained, and a sequence of 50 nt was slid up and down from the human reference genome (hg19, since mutation information was based on hg19) to construct a normal reference sequence, and then the corresponding position was replaced with a mutation site or sequence. Thus, the mutation sequence was constructed and processed, and the two formed a reference-mutation sequence pair [10]. A program was written to obtain the PQS of the reference sequence and mutation sequences by regular matching, including the positive and negative chains. After the PQSs were obtained, statistical analysis was performed.
6.2 Cell lines and culture
One common human CRC cell line (SW480) was obtained from Suzhou Haixing Biosciences (Suzhou, China), and one normal human colon cell line (NCM460) was obtained from Peking University Health Science Center, Beijing, China. All cells were grown in DMEM with 12.5 mM glucose, 4 mM glutamine, 5% fetal bovine serum (10270, Gibco, Thermo Fisher Scientific, Waltham, MA, USA) and 1% streptomycin/penicillin at 37°C in a 5% CO2 atmosphere.
6.3 MTT assay
Cells seeded in 96-well plates at a density of 5×103 cells per well were incubated in 37°C in a 5% CO2 atmosphere for 48 h. The medium was removed and cells were then incubated with 100 µL of a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT, Sigma, USA) solution (5 mg/ml) for 2–4 h. After discarding the medium, 100 µL DMSO were added and gently mixed for 10 min. Finally, the absorbance at 570 nm was measured by a microplate reader (Synergy H1, BioTek, USA). Three replicates per condition were assayed, and the average values from three to five separate experiments are presented. Data are expressed as a percentage of the control.
6.4 CRISPR/Cas9 knock-out (KO) TP53 gene
We used CRISPR/Cas9 to knock out TP53 gene (Gene ID: 7157) in SW480 cells. A pX330 p53 vector (Addgene, plasmid # 42230) was used to knock-out human mutant p53 [11]. SW480 cells were transfected with pX330 vector harboring sgRNA specific to human p53 using FugeneHD reagent (Promega, USA) (gRNA sequence: 5’ - CTTCCCACAGGTCTCTGCTA − 3’). After 48 h, single cells were plated on 96 well plates and upon clone expansion, p53 expression levels were examined by PCR, gel electrophoresis, and sequencing.
6.5 Serum collection and patient information
Serum samples (n = 27) were obtained from patients who underwent surgical resection of primary CRC between 2020–2022 at Peking University People's Hospital. Normal samples were obtained from healthy volunteers undergoing routine physical examinations at the medical examination center. The research protocol was approved by the Ethics Committee of Peking University People's Hospital (2018PHB193-01), and all patients provided appropriate informed consent. The work was carried out in accordance with The Code of Ethics of the World Medical Association (Declaration of Helsinki).
6.6 Determination of G4
DNA samples were extraction the kits (TransGen Biotech, Beijing, China) and refer to the manufacturer's instructions. G4 was determined using ThT (Thioflavin T) fluorescence spectroscopy [12, 13]. We used the sequence (5’ - GGGTTAGGGTTAGGGTTAGGG − 3’) of the G4 structure of human telomeres as the G4 standard sequence [14–16], and this sequence as the G4 standard sample (G4 standard) by gene synthesis. Before analysis, the G4 standard were heated at 90°C for 5 min at 10 µM concentration in water, then diluted into 100 mM Tris-HCl, pH 7.5, 10 mM KCl, 5 mM MgCl2, and slowly cooled to room temperature (22–25°C) over 1 h. Experiments were performed using 96-well black microplates from BBI (Sangon, Shanghai, China). Each condition was tested at least in triplicate in a volume of 20 µL for each DNA sample. Measurements were taken at room temperature (22–25°C). The G4 standard and ThT were mixed at final concentrations of 1 and 0.5 mM, respectively. Fluorescence emission was detected at 490 nm after excitation at 440 nm in a microplate reader (Synergy H1, BioTek, USA). Experiments were performed under the same conditions as used for the fluorescence single-wavelength measurements, except that the fluorescence emission was collected between 460 and 600nm every 5 nm with a microplate reader (Synergy H1, BioTek, USA).
6.7 Data processing and drawing
T-test was performed to calculate the difference p value, the histogram was plotted using Graphpad prism v8.8, and the ROC curve was plotted using R language. Data were expressed as mean ± SE.