4.1. Ethical clearance
Animal experiments were performed according to the Institutional Ethics Committee & Institutional Animal Ethical Committee (IHEC) of Postgraduate Institute of Medical Education and Research, Chandigarh, India. All the mice were bred and housed in the specific pathogen-free facilities of the Institute Animal Facilities (PGIMER, Chandigarh, India) with free access to food and water. The Animal Ethics Committee approved the procedure (Ref No. 259 82/IAEC/525) and Institute Bio-safety Committee (Ref No. 76/IBC/2016), following Institutional, National, and European Union guidelines.
4.2. T. vaginalis culture
T. vaginalis trophozoites obtained from the stock library of the Department of Medical Parasitology, PGIMER, Chandigarh, India. Trophozoites were grown in a glass screw-cap tubes containing 10ml of Diamond’s TYI-S-33 medium (pH 6.8) 38 supplemented with 10% heat-inactivated horse serum, 2.5 µg of amphotericin B, 100 U of penicillin (Himedia), 100 µg of streptomycin per ml at 37°C. Cultures were passaged on 3rd day.
The isolates which were isolated from Symptomatic trichomoniasis patient were labeled as ‘Symptomatic group’ and the isolates which were isolated from Asymptomatic trichomoniasis subjects, were labeled as ‘Asymptomatic group’ and were used for the infection in the mice models and HeLa cells. For all the experiments, seven isolates of Symptomatic T. vaginalis isolate were pooled together (Symptomatic Tv isolates) and five isolates of Asymptomatic T. vaginalis isolates were pooled together (Asymptomatic Tv isolates) and were used for further inoculations in mice model and Hela cells.
4.3. Mammalian cell culture
Complete media DMEM (Pan Biotech) supplemented with 10% of heat-inactivated fetal bovine serum FBS (Life Technologies, California, USA), 1% Antibiotic-Antimycotic solution (Thermo Fisher Scientific) was used to culture HeLa cells (ATCC, Manassas, VA, USA). HeLa cells were then cultured in the medium for 24 hrs at 37°C in a CO2 incubator. HeLa cells were trypsinized and seeded in 6 well plates for Tv infection. After infection for 1hrs, 2hrs, 4hrs, 6hrs, 8hrs, 10hrs, 24hrs, and 48hrs; the supernatant was collected, centrifuged for 30 min at 4°C for 13000rpm and was stored at -80°C for further use.
4.4. Cytokine measurement
We tried to understand the difference in pathogenesis of symptomatic and asymptomatic Tv isolates. For this, we infected HeLa cells with symptomatic and asymptomatic Tv isolates. HeLa cells were stimulated with symptomatic and asymptomatic Tv isolates for 1hr, 2hrs, 4hrs, 6hrs, 8hrs, 10hrs, 24hrs, 48hrs, and the supernatant was collected and stored in -20°C for measuring cytokine levels. The level of cytokines IL-1β(Cat# 88-7261-22, affymetrix Bioscience, Imperial Life Sciences, India)(Cat# KB1063; Krishgen Biosystems, CA, USA), IL-6(Cat# 88-7066-22, affymetrix Bioscience, Imperial Life Sciences, India), IL-8(Cat# 88-8086-22, affymetrix Bioscience, Imperial Life Sciences, India), TNF-α(Cat# 88-7346-22, affymetrix Bioscience, Imperial Life Sciences, India), IFN-γ(Cat# 88-7316-22, affymetrix Bioscience, Imperial Life Sciences, India), and TGF-β (Human IL-TGF-β GENLISA™ ELISA pre-coated (Cat# KB1036; Krishgen Biosystems, CA, USA)),was estimated by enzyme-linked immunosorbent assay (ELISA) using Ready-SET-Go ELISA kits. After observing differential cytokine production in HeLa cells in response tosymptomatic and asymptomatic Tvisolates we infected BALB/c mice with Tv for 2, 4, 8, and 14dpi and vaginal washes and serum sample was collected and stored at -20°C for further use. The level of cytokines MCP-1 (Cat# E-EL-M3001; Krishgen Biosystems, CA, USA), and IL-18 (Cat# E-EL-M0730; Krishgen Biosystems, CA, USA) was estimated by ELISA using pre-coated ELISA kits. ELISA was performed strictly following the manufacturer’s instructions. Each experiment was performed in duplicates.
4.5. Bacterial strain and growth conditions
L. acidophilus MTCC 10307 was purchased from the Institute of Microbial Technology (IMTECH), Chandigarh and cultured overnight in Man, Rogosa Sharp (MRS) broth (Himedia) at 37°C, 5000rpm 39.
4.6. Inoculation of BALB/c mice and establishment of infection
Six-eight week old female BALB/c mice, 22–24 gm, were taken and grouped as: Control Group (no Tv infection), Symptomatic Group (mice infected with Symptomatic Tv isolates), and Asymptomatic Group (mice infected with Asymptomatic Tv isolate) for different time intervals (2, 4, 8, and 14 day post-infection (dpi)). Six mice were used in each group.
The infection protocol was followed as reported by a previous study 40.Before inoculation 0.05 ml of Estradiol Valerate (10 mg/ml) was subcutaneously administered into mice’s flank region. On the day3, mice were inoculated with 109 lactobacilli intravaginally for two consecutive days. On day8, Estradiol was injected in mice. On the day 10th and 11th, 50µl of 108trichomonads per ml (Symptomatic and Asymptomatic Tv isolates) were administered intra-vaginally. In the final phase of the experiment, animals were euthanized using Sodium penthol I/P (40mg/kg body weight). The vaginal and cervical tissues were harvested on 2nd, 4th, 8th, and 14th dpi and tissues were fixed in formalin for sectioning and small part were stored in RNAlater.
4.7. Primer designing
Forward and reverse primers for Real Time-PCR amplification were designed using “Gene Runner” software version 6.5.48. Formation of primer dimer, hairpin loop, internal loop GC% was checked, and optimum primers were selected:
tlr1 > NM_001276445 [F- 5′ CCAAACGCAAACCTTACCAGAG 3′, R- 5′ ATGCTTGAGGCTGACTGTTGG 3′ (261bp)];
tlr2 > NM_011905.3 [F 5′ TTTGCTCCTGCGAACTCCTATC 3′, R- 5′ GAGGCGGAGAGTCACACAGG 3′ (99bp)];
tlr4 > NM_021297.3[F- 5′ ATGAGGACTGGGTGAGAAATGAG 3′, R- 5′AGACACTACCACAATAACCTTCCG 3′ (164 bp)];
tlr5 > NM_016928.4 [F- 5′ GTCCATTTGCCACACATCCAC 3′, R- 5′ GAAAAACATCCCAACAGAGGC 3′ (250bp)];
tlr9 > NM_031178.2 [F- 5′ CTGAGCCACACCAACATCCTG 3′, R- 5′ TCTTGTAGTAGCAGTTCCCGTCC 3′ (97bp)];
Irf3 > NM_016849.4 [F- 5′ACCTACCGAAGTTATTTGATGGC 3′, R- 5′ AGTTGTTCACATTGGGGCTTGG 3′ (117bp)];
Map3k > NM_016896.3 [F- 5′ GGGGTCCTGCTTACTGAGAAAC 3′, R- 5′ TCTGCTTGTCCTTCATTCTGTGG 3′ (130bp)];
18s > NM_011296.2 [F- 5′GTGGTGTTGAGGAAAGCAGACA 3′, R- 5′ TGATCACACGTTCCACCTCATC 3′ (72 bp19]
4.8. Real-time PCR
Approximately 25µg cleaned vaginal and cervical tissue was homogenized after adding 500µl of trizol. Total RNA was isolated by Phenol and chloroform method. The RNA pellet was washed with ethanol (70%) and dried in air at RT; the pellet was dissolved in 50 µl of TE buffer (pH 8.0) and stored at + 4˚C. The RNA’s integrity was tested by running on 2% agarose gel at 80V and visualized on UV-transilluminator. Also, the RNA was measured quantitatively by a Nanodrop spectrophotometer. cDNA was synthesized from 1 µg of total RNA by Revert Aid First-strand cDNA synthesis kit according to the manufacturer’s instructions and stored at -20°C for further use.
Reaction mixture for a single reaction was as follows: 1X SYBR Green Dye 7.5µl, 1 µl of 5 pmol each of forward and reverse primers, 1µl of 100 ng cDNA template, and 4.5µl of nuclease-free water to a final volume of 15 µl. The program used was; activation at 95ºC for 5 min followed by 40 cycles with 10 s at 95ºC, and 1 min elongation at 60ºC and Applied Biosystems 7300 (Thermo Fischer Scientific, USA) was used for all quantitative real-time PCRs. Negative control (without template cDNA) was used to eliminate reagent or DNA contamination, respectively. PCR products were analyzed by electrophoresis on 2% agarose gels and visualized by ethidium bromide staining.
Relative quantification values were expressed using the ΔΔCt method normalized to the reference gene and related to the controls (Ginzinger 2002) and calculated as mentioned below. Normalization: delta-Ct (sym/asym) = (Ct of gene in sym/asym) – (Ct of 18S rRNA in mice). delta-Ct (Control) = (Ct of gene in Control) – (Ct of 18S rRNA in Control). delta-delta-Ct = delta-Ct (sym/asym) – delta-Ct (Control). Relative quantification = 2-(delta−delta−Ct)41.
4.9. Histopathology of tissue
Vaginal and cervical tissues were fixed and processed and embedded in paraffin blocks. 5 microns thin sections were mounted and stained with hematoxylin and eosin (H & E). Sections were observed by light microscopy for checking the pathological changes like desquamation, neutrophil infiltration, congestive vesicles, and inflammation by a pathologist by a blindfold method.
4.10. Immunohistochemistry of tissues
Sections (5µm) were dewaxed in xylene, followed by xylene removal and rehydration in graded ethanol (90 − 70%) and permeablized in methanol. Sections were treated in 3% (vol/vol) hydrogen peroxidase in methanol to block endogenous peroxidase activity. Then antigen retrieval was done in 10 mM citrate buffer (pH 6.0) by using microwave heating technique. 10% FBS in PBS buffer was used for blocking. Slides were incubated overnight at 4°C, with primary antibodies diluted in PBS buffer-0.5% BSA (pH 7.6) at 1/200 of anti-IL-10 (Elabscience Biotechnology, Inc), anti-TGF-β(Elabscience Biotechnology, Inc), anti-MIP-2(Elabscience Biotechnology, Inc), anti-TLR1 (H-90), anti-TLR2 (A-9, Santa Cruz Biotechnology, INC) antibody, anti-TLR4 (76B357.1, Santa Cruz Biotechnology, INC) antibody, anti-TLR5 (H-127, Santa Cruz Biotechnology, INC) antibody and anti-TLR9 (H-100, Santa Cruz Biotechnology, INC) antibody. Tissue sections were rinsed thrice in PBS buffer (pH 7.4) and incubated for 30 min with goat anti-rabbit(Abcam, Cambridge, USA)/mouse-secondary (Santa Cruz, California, USA) antibody (1:500), then slides were incubated in DAB solution for 10 min. Slides were rinsed, counterstained with hematoxylin, and mounted using DPX and observed under fluorescent microscope at 20X.
4.11. Statistical analysis
Duplicate sets of each sample were used, and no template controls were used as a negative control, cycle threshold (CT) values were recorded. Data of all the samples are shown as mean ± standard deviation. Statistical differences were determined using a two-way analysis of variance (ANOVA) with Bonferroni assay for multiple comparisons. Duplicate sets of each sample were performed, and the sections of tissue in the images were used to measure mean intensity and optical density using ImageJ software. For ELISA, duplicate sets of each sample were performed. Confidence intervals were considered as 95% of confidence. All tests were performed using Graphpad Prism statistical software.