Clinical specimens
Between January 2012 and October 2014, 172 pairs of CRC tumor tissues and corresponding adjacent normal tissues were collected from patients with CRC who underwent surgery at Xuzhou Medical University Affiliated Hospital (Xuzhou, China). Patients did not receive any radiotherapy or chemotherapy before surgery. Samples were pathologically confirmed and rapidly placed into liquid nitrogen after surgical operation until use. CRC patients were staged according to the TNM staging system (the 7th edition) of the American Joint Committee on Cancer. Details of the clinicopathological data are shown in Table 1. When the expression of MK5-AS1 was greater than the average, MK5-AS1 was considered to be high and vice versa. The study protocol was approved by the Research Ethics Committee of Xuzhou Medical University. Clinical specimens were obtained with the informed consent of patients.
Cell lines and culture
Human CRC cell lines (HCT116, SW620, SW480, DLD-1, HT-29) were purchased from the Cell Bank of the Chinese Academy of Science (Shanghai, China). The human normal colorectal epithelial cell line FHC was obtained from the American Type Culture Collection (Manassas, VA, USA). Cell lines were cultured in the appropriate medium supplemented with 10% fetal bovine serum (FBS; Gibco, NY, USA) and 1% antibiotic/antimycotic solution and maintained in an incubator at 37°C with 5% CO2 in a humidified atmosphere. DLD-1 and HT-29 cells were maintained in RPMI-1640 medium (Gibco), FHC cells were cultured in Dulbecco’s modified Eagle medium (DMEM; Gibco), HCT116 cells were maintained in McCoy’s 5A medium (KeyGEN, Nanjing, China) and SW620 cells were maintained in L-15 medium (KeyGEN). To test the effects of the N-terminal phosphorylation of c-Jun, HCT116 and SW620 cells were pretreated with SR11302 (10 μM for 1 h) (APExBIO, USA) before transient transfection[30].
Quantitative real-time PCR (qPCR)
According to the manufacturer's instructions, total RNA from CRC tissues and cells was isolated and quantified using TRIzol reagent (Takara, China). LncRNAs, miRNAs and mRNAs were reverse transcribed in accordance with the manufacturer's protocol by using PrimeScript RT Master Mix (Takara). The relative quantification of MK5-AS1 was carried out by the 2-ΔΔCT method, and 18S rRNA was used as an internal control. The expression levels of let-7f-1-3p and miR-1284 were normalized to the levels of internal control U6 by the 2-ΔΔCT method. The expression levels of MK5 and SNAI1 were normalized to the levels of the internal control GAPDH by the 2-ΔΔCT method. The reactions were performed independently in triplicate. Quantitative PCR assays were carried out on ABI StepOne (Carlsbad, CA, USA). The primer sequences are MK5-AS1 Forward 5'-GGCGTCGTGAGGTATGGATGTTC-3' Reverse 5'-GCTTGACCACTTCTCGGCTGTG-3'; miR-1284 RT primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGAAAAG Forward 5'-CGCGTCTATACAGACCCTGG-3' Reverse 5'-AGTGCAGGGTCCGAGGTATT-3'; let-7f-1-3p RT primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGGAAG Forward 5'-GCGCGCTATACAATCTATTGC-3' Reverse 5'- AGTGCAGGGTCCGAGGTATT-3'; MK5 Forward 5'-AAAAACTCCGAGATGTGATTGC-3' Reverse 5'-GAGTTTGCATTCCCGGTTATAC-3'; SNAI1 Forward 5'-TCCAGAGTTTACCTTCCAGCA-3' Reverse 5'-CTTTCCCACTGTCCTCATCTG-3'; 18S rRNA Forward 5'-CCTGAGAAACGGCTACCACAT-3' Reverse 5'-CACCAGACTTGCCCTCCA-3'; GAPDH Forward 5'-CAAGGTCATCCATGACAACTTTG-3' Reverse 5'-TCCACCACCCTGTTGCTGTAG-3'; U6 Forward 5'-GCTTCGGCAGCACATATACTAAAAT-3' Reverse 5'-CGCTTCACGAATTTGCGTGTCAT-3'.
Cell transfection
Negative control siRNA (si-NC) and four individual MK5-AS1 siRNAs (si-MK5-AS1 #1, #2, #3, #4), three individual MK5 siRNAs (si-MK5 #1, #2, #3), c-Jun siRNA, let-7f-1-3p mimics, and let-7f-1-3p inhibitor were purchased from Gene Pharma (Shanghai, China). The siRNA sequences are si-MK5-AS1 #1 5'-CGAGAAGUGGUCAAGCUAGAA-3'; si-MK5-AS1 #2 5'-CGUCUUUACAAGGUAGCCGUU-3'; si-MK5-AS1 #3 5'-GGAGUCGGACACACACCUA-3'; si-MK5-AS1 #4 5'-GCUGUAAAGCGCGAUCCAC-3'. si-MK5 #1 5'-CCAGUUAGAGUCUGUGUAA-3'; si-MK5 #2 5'-GCACUUUACAGAGAAGCAA-3'; si-MK5 #3 5'-GGAGUCAGAUCUCAGAGAU-3'. si-c-Jun 5'-GGGUGCCAACUCAUGCUAA-3'. si-negative control 5'-TTCTCCGAACGTGTCACGT-3'. let-7f-1-3p mimics 5'-CUAUACAAUCUAUUGCCUUCCC-3'; let-7f-1-3p inhibitor 5'-GGGAAGGCAAUAGAUUGUAUAG-3'; miR inhibitor NC 5'-CAGUACUUUUGUGUAGUACAA-3'; Negative control 5'-UUCUCCGAACGUGUCACGU-3'. Cells were transfected with siRNA when at 30-50% confluence using siLentFect Lipid Reagent (Bio-Rad, CA, USA). MK5-AS1, MK5, and c-Jun were amplified from human cDNA as a template and were cloned into the pcDNA3.1(+) vector (Invitrogen, USA). The c-Jun-S63A sequence was thereafter generated using overlap extension PCR and cloned into pcDNA3.1(+). HCT116 and SW620 cells were grown to 90% confluence before being transiently transfected with plasmids using Lipofectamine 2000 (Invitrogen), according to the manufacturer’s protocol. At 24-48 h posttransfection, cells were harvested for qPCR or western blot analysis.
Cell proliferation assay (CCK8 assay and colony formation assay)
A cell proliferation assay was performed with the Cell Counting Kit-8 (CCK8) assay (APExBIO). Equal numbers of HCT116 and SW620 cells 24 h after transfection with si-MK5-AS1, si-MK5, let-7f-1-3p inhibitor and let-7f-1-3p mimics were seeded into 96-well plates. CCK8 solution (10 μl per well) with 100 μl serum-free medium was added every 24 h, and the plates were incubated at 37°C for 2 h. The optical density (OD) was then measured at 450 nm. For the colony formation assay, HCT116 and SW620 cells transfected similarly were plated in each well of a six-well plate and cultured in the appropriate medium containing 10% FBS for approximately 14 days, and the medium was replaced every 5 days. After 14 days, the colonies were fixed with methanol and stained with 0.1% crystal violet (Vicmed, China). The colony formation rate was determined by counting the number of stained colonies.
Migration and invasion assays
The cell migration and invasion abilities were evaluated by a modified bicameral culture system with a pore size of 8 μm. Transwell inserts (Corning Incorporated, USA) with or without Matrigel (BD Biosciences, USA) coating were used to perform the invasion or migration assays, respectively. The transfected cells were seeded into transwell inserts. After culture, cells were fixed with 4% paraformaldehyde solution and stained with 0.1% crystal violet. Then, we used an Olympus microscope to obtain images at a magnification of ×100 and then used ImageJ software to calculate the number of cells penetrating the pores. All experiments were carried out three times.
Immunoblotting, coimmunoprecipitation (co-IP) and antibodies
Cells were harvested with RIPA lysis buffer (Beyotime, China) supplemented with PMSF, phosphatase inhibitor cocktail and protease inhibitor cocktail (Sigma Aldrich, MO, USA). Lysates were cleared by centrifugation at 13,000 g for 15 min at 4°C. Cell protein lysates were quantified and separated by electrophoresis on SDS-polyacrylamide gel electrophoresis, transferred to a nitrocellulose filter membrane, blocked with 5% skim milk (BD Biosciences) in Tris-buffered saline with 0.05% Tween-20, and probed with specific antibodies. The signals were detected using Chemistar™ High-sig ECL Western Blot Substrate (Tanon, Shanghai, China). Similarly, human tissues were ground and then prepared in RIPA buffer as mentioned before. For co-IP, cell lysates (1000 μg) containing a cocktail of protease/phosphatase inhibitors were rotated overnight for immunoprecipitation with anti-c-Jun IgG, anti-MK5 IgG, anti-RBM4 IgG, anti-eIF4A1 IgG and rabbit IgG (Beyotime, China). Then, 30 μl of Protein A/G agarose beads (Santa Cruz Biotechnology, USA) was added to the cell lysates and incubated for 4 h at 4°C. Beads were washed with lysis buffer three times. The immunoprecipitation complexes were analyzed by western blot. Antibodies against the following proteins were used: MK5 (1:1000; Santa Cruz Biotechnology); c-Jun (1:200; Santa Cruz Biotechnology); p-c-Jun (1:5000; Abcam, USA); N-cadherin (1:2000; Abcam); E-cadherin, vimentin, SNAI1, SNAI2, and RBM4 (1:1000; Proteintech, Wuhan, China); eIF4A1 (1:1000, Cell Signaling Technology, USA); GAPDH (1:1000; ABM, Canada); goat anti-rabbit HRP, and goat anti-mouse HRP (1:10,000, Vicmed).
RNA-Fluorescence in situ hybridization (RNA-FISH)
HCT116 cells were washed twice with PBS and fixed in 4% formaldehyde for 15 min. The fixed cells were permeabilized with Triton X-100 and dehydrated by an ascending series of ethanol concentrations. The cells were then incubated with 50 nmol probe labeled with CY3 at the 5' end in hybridization buffer at 73°C for 5 min. Cells were hybridized at 37°C for 14 h, washed and dehydrated. After adding DAPI working solution, the cells were scanned and imaged. RNA FISH probes were designed and synthesized by Sangon Biotech (Shanghai, China). The detection probe sequence was 5'-AACATCCATACCTCACGACGCCAAACGGCTACCTT-3'; the negative control probe sequence was 5'-AAGGTAGCCGTTTGGCGTCGTGAGGTATGGATGTT-3'.
RNA pull-down assay
Biotin-labeled RNAs were transcribed with T7 RNA polymerase (Takara) and biotin labeling mix (Roche, USA). The product was treated with RNase-free DNase I and purified with the RNeasy Mini kit (Qiagen, MD, USA). We used the Pierce Magnetic RNA-Protein Pull-Down Kit (Thermo Fisher, USA) according to the manufacturer’s instructions. The biotin-labeled RNAs (1 μg) were first folded in RNA structure buffers (20 mM Tris-HCl [pH 7.0], 0.2 M KCl and 20 mM MgCl2) for 20 min and then coincubated with HCT116 cell lysates and 100 U/ml RNase inhibitor at 4°C for 12 h. After incubation, the RNA/protein complex was captured by magnetic streptavidin-coupled beads, washed twice in washing buffer and eluted in elution buffer. The eluted lncRNA-interacting proteins were separated by SDS–PAGE and standard immunoblotting.
RNA immunoprecipitation (RIP) assay
HCT116 cells lysates were coincubated with anti-RBM4 IgG and anti-eIF4A1 IgG at 4°C for 12 h. The immune complex was conjugated with 30 μl Protein A/G beads. After 3-6 h, the beads were washed and then directly resuspended in TRIzol reagent and subjected to RNA isolation. Finally, specific primers were used for qPCR analysis of immunoprecipitated RNA to confirm the presence of MK5-AS1.
Dual luciferase reporter assay
The sequences of human MK5-AS1 and SNAI1 3'UTR were cloned into pGL3-basic (Promega, USA) at the XbaI site. Similarly, the SNAI1 promoter was cloned into pGL3-basic between the KpnI and XhoI sites. All mutant SNAI1 promoter and 3'UTR sequences were amplified by overlap extension PCR. HCT116 cells seeded in a 24-well plate were cotransfected with expression plasmids and RNA oligos using Lipofectamine 2000. The relative activity of firefly luciferase was assessed by the Dual-Luciferase Reporter Assay System (Promega) after 48 h of transfection and normalized to that of Renilla luciferase. All experiments were repeated in triplicate.
Chromatin immunoprecipitation (ChIP) assays
HCT116 and SW620 cells were transfected with c-Jun plasmids for 24 h. The ChIP assay was performed with an EZ-ChIP kit (Millipore, USA) according to the manufacturer’s protocol. The harvested cells were lysed by SDS lysis solution, and the DNA samples were reduced to 500-1000-bp fragments by ultrasound. DNA fragments were coincubated with anti-c-Jun IgG, rabbit IgG or anti-RNA pol II IgG at 4°C for 12 h. The immune complex was conjugated with 40 μl Protein A/G beads. After 1-2 h, the protein/DNA complexes were washed and then eluted in an elution buffer containing 1% SDS and 0.1 M NaHCO3, and the DNA was purified by a DNA cleanup spin column. The presence of specific DNA sequences in the eluted sample was measured by PCR. The SNAI1 promoter sequences are Negative SANI1 promoter Control Forward 5'- CGTCCCGTCTCTCCCCCAC-3' Reverse 5'-CGTTCCTTCCCTTATCCAGTGTTT-3'; Positive SNAI1 promoter Control Forward 5'-CCCCGCCTCGGAGGAGTC-3' Reverse 5'- AGCGCCGCCAACTCCCTTA-3'; SNAI1 promoter Forward 5'-CCTTGAGGCAAAGTCCAAACTC -3' Reverse 5'-AAGTGTGCTTTGGTGGGGGA -3'.
Lentiviral transduction and tumor xenograft experiments
HCT116 cells labeled with luciferase were infected with lentiviruses expressing GFP and carrying sh-negative control, sh-MAPKAPK5-AS1, or sh-MK5 by 8 mg/ml Polybrene (Gene Pharma). The shRNA sequences are sh-MAPKAPK5-AS1 5'-AATTCAAAAAACGAGAAGTGGTCAAGCTAGAATCTCTTGAATTCTAGCTTGACCACTTCTCGCG-3'; sh-MK5 5'-AATTCAAAAAAGCACTTTACAGAGAAGCAATCTCTTGAATTGCTTCTCTGTAAAGTGCG-3'; sh-negative control 5'AATTCAAAAAATTCTCCGAACGTGTCACGTTCTCTTGAAACGTGACACGTTCGGAGAA-3'. All animal experiments were approved by the Committee on the Ethics of Animal Experiments of the Xuzhou Medical University. All animal studies complied with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. BALB/c female nude mice were provided by HFK Bioscience (Beijing, China) and randomized into four groups (n = 7 for each). A total of 3 × 106 Ctrl-HCT116 cells, sh-MK5-AS1 HCT116 cells and sh-MK5 HCT116 cells suspended in 150 μl PBS were injected into mice through the tail vein. The metastatic tumor numbers were measured every 3 days with a whole-body fluorescent imaging system. After 2 months, mice in all four groups were sacrificed, and pulmonary tumors were isolated for imaging, statistical analysis and hematoxylin and eosin (HE) staining.
Statistical analysis
Statistical analysis was performed by SPSS 17.0 software (SPSS, USA), and images were acquired with GraphPad Prism 5 software (La Jolla, USA). The significance of the differences between the groups was evaluated by a paired two-tailed Student’s t-test or χ2 test. The correlation analysis between MK5-AS1, let-7f-1-3p and MK5 was evaluated by Spearman’s test. The Kaplan-Meier method and log-rank test were used to evaluate the overall survival (OS). Data represent the mean ± standard deviation (SD). Differences were considered statistically significant when P<0.05 (* P<0.05, ** P<0.01, *** P<0.001).