Transfection of pAi1C9:
4 x 107 T. b. brucei 427 procyclic forms were transfected with 10 µg pAi1C9 dissolved in 100 µl TbBSF transfection buffer [10], using an Amaxa Nucleofector IIb (Lonza), program X-014 [11]. Cells were transferred to 13 ml SDM79 medium [12] supplemented with 10 % FBS and incubated at 27 °C and 2.5 % CO2 for 20 hours.
Transfection of pooled PCR products for repair constructs and sgRNA templates:
The entire culture from the first transfection was centrifuged at 1700 g for 5 min, the supernatant discarded and the cells resuspended in 100 µl TbBSF transfection buffer containing the pooled PCR products (see protocol for PCRs below). For tagging one sgRNA template (targeted to the 3’ end of the ORF) and one repair template (hygromycin resistance) were provided; to generate the knockouts, we provided two sgRNA templates (targeted to the 5’ and 3’ ends of the ORF) and two repair templates (hygromycin and neomycin resistance genes).
Transfection was performed as described above and the cells were transferred to 10 ml SDM79 supplemented with 10 % FBS. The cells were diluted 1:5, 1:50 and 1:500 in conditioned medium (fresh medium + 20 % supernatant of a log-phase culture) and distributed into 24-well plates (1 ml in each well). Transformants were selected using 25 µg ml−1 Hygromycin B and/or 15 µg ml−1 Geneticin; stable clones were obtained two weeks post selection.
Polymerase chain reactions (PCR):
Reactions were performed with reagents from New England Biolabs: Phusion High-Fidelity DNA polymerase (M0530S), 5 x Phusion HF buffer (B0519S) and dNTP mix (N0447S). Cycling conditions are identical to those previously published [4, 13].
-1st PCR: template for sgRNAs; two 20 µl reactions per target
1 μl G00 primer (0.5 μM)
4 μl 5 x Phusion HF buffer
0.5 μl dNTP mix (250 μM)
1 μl sgRNA primer (0.5 μM)
0.2 μl Phusion High-Fidelity DNA polymerase (0.4U)
13.3 μl H2O
-Program: 1) 30’’, 98 °C
2) 10’’, 98 °C
3) 30’’, 60 °C
4) 15’’, 72 °C
5) go to step 2, 35 cycles in total
6) 10’, 72 °C
7) hold at 10 °C
-2nd PCR: template for resistance gene; two 40 µl reactions per resistance gene
2 μl 60 ng pPOTv7 mNG (hygro or G418) plasmid
8 μl 5 x Phusion HF buffer
1 μl dNTP mix (250 μM)
2 μl Upstream forward primer (0.5 μM)
2 μl Downstream reverse KO/TAG primer (0.5 μM)
0.4 μl Phusion High-Fidelity DNA polymerase (0.4U)
24.6 μl H2O
-Program: 1) 5’, 94 °C
2) 30’’, 94 °C
3) 30’’, 65 °C
4) 2’30’’, 72 °C
5) go to step 2, 40 cycles in total
6) 10’, 72 °C
7) hold at 10 °C
DNA purification after PCR:
PCR reactions were pooled and extracted with 1 volume water-saturated phenol (pH 8), followed by extraction with 1 volume chloroform. DNA was precipitated from the aqueous phase by addition of 0.1 volume 3 M sodium acetate, pH 5.2, and 3 volumes ice-cold ethanol. The DNA was pelleted by centrifugation, washed twice with 1 ml 80 % ethanol, air-dried at room temperature, dissolved in 40 μl Milli-Q-water and stored at -20°C until transfection.
Primers:
G00: aaaagcaccgactcggtgccactttttcaagttgataacggactagccttattttaacttgctatttctagctctaaaac
PDEB1 3' sgRNA primer:
gaaattaatacgactcactataggTGAAGAAGTCAGTTGACCGGgttttagagctagaaatagc
Trypanin 5' sgRNA primer:
gaaattaatacgactcactataggCAAAAACGAGAAGAGCCTACgttttagagctagaaatagc
Trypanin 3' sgRNA primer:
gaaattaatacgactcactataggAGGTGTTGTGGTTCACACGTgttttagagctagaaatagc
GPI8 5' sgRNA primer:
gaaattaatacgactcactataggCGGTTGCAAAAAACGAATGCgttttagagctagaaatagc
GPI8 3' sgRNA primer:
gaaattaatacgactcactataggGGTATGTCCCATCAGTTGGAgttttagagctagaaatagc
Trypanin upstream forward primer:
TACTTTTCAGACTGCATCGTGGCGTACCCCgtataatgcagacctgctgc
Trypanin downstream reverse KO primer:
CTGCAACAAAGCCGTAACTTGGAACAACCAccggaaccactaccagaacc
PDEB1 downstream forward primer:
ACGAGTTCTGGCAACAACAGCAGTACTCGTggttctggtagtggttccgg
PDEB1 downstream reverse TAG:
ATCACCATTGACAAGAACGTACATCTACCAccaatttgagagacctgtgc
GPI8 upstream forward primer:
TTGGATCAGGCGCTTGCATATTTATTTCCAgtataatgcagacctgctgc
GPI8 downstream reverse KO primer:
AGTTTCAGGAAGGAAGTTCGTTTTTCTCCTccggaaccactaccagaacc