This research was approved by the Ethics Committee and Institutional Review Board of Shanghai General Hospital. All animal experiments were conducted in compliance with the Association for Research in Vision and Ophthalmology Statement for the Use of Animals in Ophthalmic and Vision Research.
Amyloid Oligomerization
Oligomeric Aβ1-40 peptide (Sigma, A1075) was prepared according to the manufacturer's instructions. Briefly, lyophilized Aβ1-40 peptides were dissolved in deionized distilled water (approximately 6 μg/μL). The solution was further diluted with phosphate-buffered saline (PBS) to a final concentration of 1.5 μg/μL (350 μM) before incubation for 4 days at 37 °C. The Aβ1-40 oligomers were stored at -20 °C before use.
Animals and Experimental Design
Eight- to twelve-week-old wild-type (WT) C57BL/6 mice (male) were provided by the Shanghai General Hospital, Laboratory Animal Center. Age-matched PFKFB3 +/- mice (male) were donated by Shanghai Institute of Immunology (Dr. Honglin Wang, Shanghai Institute of Immunology, Shanghai Jiao Tong University School of Medicine, Shanghai, China). The animals were raised in sterile enclosures. After anesthetization with 1.5% sodium pentobarbital (5 µL/g) intraperitoneally (i.p.), mice were administered a single unilateral IVL injection of oligomeric Aβ1-40 peptides (1.5 μg/2 μL) in PBS using a glass micropipette under a dissecting microscope (SM2000J, Olympus); PBS (2 μL) was injected into age-matched controls.
Fundus Photography and Optical Coherence Tomography (OCT)
Fundus imaging and OCT scans of anesthetized mice was carried out using the Phoenix MICRON IV system (Cold Spring Harbor Corp.) after pupil dilatation with 1% tropicamide (Alcon). The optic nerve marked the center of the images for analyzing.
Hematoxylin and Eosin (H&E) Staining
The mice were sacrificed 3 days after IVL injection of oligomeric Aβ1-40. After enucleation, eyeballs were fixed with 4% paraformaldehyde (PFA) for 2 hours and dehydrated overnight with 10% sucrose at 4°C. The tissue sections were then cut to a thickness of 10 μm after embedded in paraffin. After deparaffinization and rehydration, sections were treated with sodium citrate buffer (pH 6.0, 10 minutes) and blocking buffer (10% normal goat serum, 0.05% Triton X-100 in PBS; 1 hour, room temperature). Then, the specimens were stained with H&E. The slides were dehydrated and placed on a coverslip.
Transmission Electron Microscopy (TEM)
TEM were used to observe Aβ1-40-induced morphologic alterations in RPE cells. The eyeballs were fixed in 4% paraformaldehyde at 4°C for over 24 h, dehydrated and embedded in paraffin following standard protocols by Servicebio, Inc. (Wuhan Servicebio Technology Co., Ltd., Wuhan, Hubei, China). The samples were further sectioned, stained and observed by transmission electron microscope by Servicebio, Inc.
Optomotor Response (OMR) Test
The subject mouse was detected with OMR-M17S01 (Ningbo Institute of Intelligent Equipment Technology Co., Ltd.), which displayed horizontally drifting sinusoidal gratings as visual stimuli as previously described.[30] Each experiment was composed of several measurements at different spatial frequencies (0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7 and 0.8, corresponding to 36, 72, 108, 144, 180, 216, 252 and 288 pattern repetitions / 360). The moving direction of the grating was consecutively clockwise. Each spatial frequency was presented for 60 s, followed by a short break of approximately 10 s. The automated measurement system provides head-tracking algorithm to analyze the head movement of the animal, which reflecting the optomotor response.[31, 32] The behavioral responses were video recorded and quantified both manually by the experimenter and automatically. The optomotor tests were performed three to four times for each mouse.
Immunofluorescence Staining
After fixation with 4% PFA, dissected eye tissues were washed with PBS and successively dehydrated with 10% sucrose before embedded in OCT and frozen on dry ice. The tissue sections were then cut to a thickness of 10 μm and blocked with 0.3% Triton X-100 and 5% goat serum albumin (Beyotime) in PBS for 1 h at room temperature. Frozen sections (15-25 mm) or RPE flat mounts were immunostained with primary antibodies against IBA1 (1:1000, Wako, 019–19741), ZO-1 (1:1000, Thermo Fisher, 33-9100) and phalloidin (1:1000, Abcam, ab176757) overnight at 4 °C. The samples were washed with PBS three times and then were stained for 45 min at 37 °C with Alexa Fluor 594- and 488-conjugated secondary antibodies (1:1000, Proteintech). The nuclei were marked by 4′,6-diamidino-2-phenylindole. The immunofluorescence was observed under a confocal microscope (Leica TCS SP8 confocal 137 microscope, Germany) and quantitatively analyzed using ImageJ software (Fiji, NIH, USA).
Cell Culture and PFKFB3 Knockdown
We cultured the immortalized murine microglial BV2 cell line and human ARPE19 cell line. All cell lines were tested for mycoplasma contamination before use. Small interfering RNA (siRNA) of PFKFB3 (GAGCCUGUGAUCAUGGAAUTT, AUUCCAUGAUCACAGGCUCTT) and TransIT-2X (MIR 6000, Mirus) were chosen for the knockdown of PFKFB3. For stimulation, 2μM oligomeric Aβ1-40 was applied for 24 h.
Western Blot Analysis
Retina samples were lysed in a lysis buffer containing 50 mM Tris‐HCl (pH 8.0), 0.1% SDS, Protease Inhibitor Cocktail (11697498001; Roche Applied Science), 150 mM NaCl, 1% Triton X‐100, and 1% sodium deoxycholate. We incubated the primary antibodies at 4 °C overnight. Next day, incubated membranes were incubated with the horseradish peroxidase (HRP)-conjugated secondary antibodies (1:3000, Proteintech). The washed membranes were screened by chemiluminescence using the Amersham Imager 600 (GE Healthcare). Band density analysis was performed with ImageJ software (National Institutes of Health, USA) and normalized to β-actin.
Quantitative RT-PCR
Total RNA was isolated by the RNA Simple Total Kit (Tiangen Biotech, China) according to the manufacturer's instructions and was measured by NanoDrop 2000c spectrophotometer (Thermo Fisher Scientific). Complementary DNA was synthesized according to the RT Master Mix protocol (Takara BioInc., China). The primer sequences were acquired from Primerbank (bank: https://pga.mgh.harvard.edu/primerbank/), including TNF-α (F: CCCTCACACTCAGATCATCTTCT, R: GCTACGACGTGGGCTACAG), IL-1β (F: GAAATGCCACCTTTTGACAGTG, R: TGGATGCTCTCATCAGGACAG), IL-6 (F: TAGTCCTTCCTACCCCAATTTCC, R: TTGGTCCTTAGCCACTCCTTC).
Flow Cytometry
BV2 Cell samples were harvested, fixed, and stained with APC anti-BrdU antibody and 7-AAD using the APC BrdU Flow kit (BD Pharmingen, 552598) following the manufacturer’s instructions. Fluorescence was acquired using CytoFLEX (Beckman Coulter) and analyzed using CytExpert software (Ver. 2.4.0.28, CytExpert, Beckman Coulter, Inc). Further analyses were carried out using FlowJo software (Tree Star Inc.).
Microglial Conditioned Medium
BV2 cells were cultured with 5 μmol/L oligomeric Aβ1-40 for 24 h. The supernatant was then collected as microglial conditioned medium (MCM) and centrifuged to remove cellular debris (5 min, at 3 000g), and the MCM was applied to the ARPE19 medium. The ARPE19 cells were then plated at 5 × 105 cells/mL in a 12-well plate for 24 h for CCK-8 cell viability and β-gal detection. The supernatant of BV2 cells without the addition of oligomeric Aβ1-40 served as the CM.
CCK-8 Cell Viability Assay
Cell viability assay was performed by using Cell Counting Kit-8 (Sigma Aldrich) according to manufacturer's protocol to evaluate the viability of ARPE19 cells after oligomeric Aβ1-40 treatment. Absorbance values were determined by microplate reader Varioskan Flash (Thermo scientific) at 450 nm with a reference wavelength of 630 nm. Cell viability was given as a percentage absorbance of untreated control cells.
β-galactosidase Staining
Senescence associated β-galactosidase (β-gal) staining kit (Beyotime Biotechnology) was used to detect β-gal activity for quantification of senescent cells. β-Gal catalyzes the hydrolysis of substrate, X-gal, which produces a blue color in senescent cells at pH 6.0. After fixation, the ARPE19 cells were incubated with 300 μl 1 × β-gal staining solution at 37 °C overnight. β-Gal positive cells were quantified by light microscopy from 3 randomly chosen different fields of view.
RNA-Sequencing and Data Analysis
Total RNA was extracted from the retina samples using TRIzol® Reagent according to the manufacturer’s instructions (Magen). For sequencing library construction, a ABclonal mRNA-seq Lib Prep Kit was used for synthesizing cDNA, PCR amplification, purifying PCR products (AMPure XP system). RNA quality was assessed by 4150 Bioanalyzer (Agilent). Sequencing was performed with a MGISEQ-T7 instrument. Sequencing Data generated from BGI platform were used for bioinformatics analysis. Quality control of raw reads was processed through in-house perl scripts, which obtained clean reads for subsequent analysis. The clean reads were aligned to reference genome with orientation mode using HISAT2 software (http://daehwankimlab.github.io/hisat2/) to obtain mapped reads. FeatureCounts (http://subread.sourceforge.net/) was used to quantify the reads numbers mapped to each gene. Subsequent data analyses were performed using R (4.2.0), STRING (https://string-db.org/cgi/input.pl), Cytoscape (3.9.1), etc.
Statistical Analysis
Statistical analyses were performed with GraphPad Prism 8.0 (GraphPad Software Inc., CA, USA). Data are presented as mean ± SEM. Differences between groups were compared using the Student’s t-test. Statistical significance was set at p < 0.05. All in vitro experiments were performed at least 3 times unless otherwise stated.