Inhibition of P2X7  receptor downregulates neuronal TRPV1 expression in rat dorsal root ganglion

doi:10.21203/rs.3.rs-2130299/v1

Download PDF

Research Article

Inhibition of P2X7 receptor downregulates neuronal TRPV1 expression in rat dorsal root ganglion

https://doi.org/10.21203/rs.3.rs-2130299/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

The purinergic 2X7 receptor (P2X7R) is an ATP-gated ion channel that can conduct extracellular signals and induce corresponding biological effects. Transient receptor potential vanilloid type 1 (TRPV1) is a non-selective cation channel that maintains normal physiological functions. Numerous studies have shown that P2X7R and TRPV1 are strongly associated with inflammatory reactions, so we aimed to investigate the effect of knockdown of P2X7R in rat satellite glial cells (SGCs) on neuronal TRPV1 expression under a high glucose and high free-fat (HGHF) environment. We found that treatment with P2X7 short hairpin RNA (shRNA) reduced the expressions of the P2X7R protein and mRNA of SCGs in the dorsal root ganglion, downregulated the release of tumor necrosis factor-alpha and interleukin-1 beta via the Ca²⁺/p38 MAPK/NF-kB pathway. After coculture of neurons with SGCs, TRPV1 expression in neurons was reduced via Ca²⁺/PKC-ɛ/p38 MAPK pathway. These results suggest that reducing P2X7R on SCGs in an HGHF environment results in decreasing neuronal TRPV1 expression via the Ca²⁺/PKC-ɛ/p38 MAPK pathway.

P2X7R

TRPV1

satellite glial cell

neuron

inflammation

cytokines

Type 2 diabetes mellitus[10, 18, 44] is a common endocrine and metabolic disease. Neuropathic pain (NPP) is a chronic condition caused by disease or damage to the somatosensory system and is also one of the complications of diabetes[8, 47, 52]. Diabetes might be considered to be an inflammatory disease, and NPP is closely related to inflammatory responses[9, 51, 68]. Some studies have shown that glial cells proliferate after nerve injury and inflammatory reactions, and participate in the occurrence and maintenance of NPP[6, 57]. The purinergic 2X7 receptor (P2X7R) is an ATP-gated ion channel widely distributed in glial cells and neurons[1, 27]. After binding to ATP, its excitation leads to Ca²⁺ and Na⁺ influx and K⁺ outflow, thereby activating cell signal transduction [21]. P2X7R regulates several signaling pathways associated with inflammation, and its role in inflammation and pain has been studied extensively [2, 45, 48].

Transient receptor potential vanilloid type 1 (TRPV1) is considered one of the key molecules in pain perception[7, 59]. It can be activated by capsaicin, ATP, H⁺ and other stimuli to cause neuronal damage, resulting in various pain sensations[3, 4]. It is a non-selective cation channel with high permeability to Ca²⁺, and Ca²⁺ and Na⁺ play an essential role in transmitting nociceptive signals from the periphery to the central nervous system through the TRPV1 [38, 40]. Under normal physiological conditions, TRPV1 can be activated by inflammatory factors produced at sites of inflammation or tissue damage, and activating TRPV1 leads to cellular depolarization, acting as an ion channel for excitable sensory neurons[35, 73]. TRPV1 can mediate neuronal apoptosis and necrosis. Its activation leads to a sustained increase in intracellular Ca²⁺ that accumulates in the mitochondria and are released from the endoplasmic reticulum. These processes lead the organelles to fragment, resulting in neuronal damage caused by increased cell size[14, 43]. Thus, increased TRPV1 activity and expression can promote damage to sensory neurons in chronic pain, leading to hyperalgesia.

Both P2X7R and TRPV1 are involved in the generation and development of NPP, and they are both associated with inflammation, but whether there is a link between them is unclear. Therefore, here we explored the influence of TRPV1 in dorsal root ganglion (DRG) neurons by inhibiting the P2X7R of satellite glial cells (SGCs) in an environment of high glucose and high free-fat (HGHF) at the cellular level. Our study provides an experimental and theoretical basis for the pathogenesis and prevention of diabetic NPP and has essential significance for discovering novel targets for clinical treatment.

2.1. Primary culture

Newborn Sprague Dawley rats (Medical Animal Experimental Center of Nanchang University) were anesthetized with ether and then decapitated and bled. After cleaning with phosphate-buffered saline (PBS), the spinal region was cut out and placed in precooled D-Hanks solution. The spinal cord was removed with pointed forceps, the DRG was placed in the precooled medium, and the nerve fibers on the DRG were peeled off with ophthalmic scissors and sharp tweezers. The separated DRG was placed in a 15 ml centrifuge tube and centrifuged for 5 min. After discarding the supernatant, 1 ml of 0.25% trypsin-EDTA was added to the centrifuge tube, mixed by pipetting, and placed in a cell incubator to digest for 30 min. DMEM/F12 medium (Shanghai Viva Cell Biosciences Ltd, China) containing 10% fetal bovine serum was added, and mixed gently to terminate digestion. After centrifuging for 5 min, the supernatant was discarded. An appropriate amount of medium was added, and whisk gently until the liquid was cloudy. After standing for 3 min, the cell suspension was filtered through a cell sieve into a new centrifuge tube. The cell suspension was inoculated into a cell culture dish for subsequent culture. The whole process was done in a sterile environment. To simulate the HGHF environment, we added 40 mM D-glucose and 0.60 mM free fatty acids [33] into the medium, where the free fatty acids were a mixture of palmitate and oleate at a 1:2 ratio (w/w)[66]. This study was approved by the Ethics Committee of Nanchang University and animals were treated according to its Guidelines for the Care and Use of Animals.

The SGCs were divided into four groups: untreated control; HGHF (0.60 mM FFAs and 40 mM d-glucose); HGHF + P2X7 shRNA; HGHF + negative control shRNA (NC shRNA). When the cells reached 70–80% confluence, P2X7 shRNA was transfected into the cells and they were treated with HGHF for 24 h for subsequent experiments.

2.2. Construction and transfection of the P2X7 shRNA expression vector

According to shRNA design principles, the sequence of the designed P2X7 shRNA was as follows: 5′–CACCGTGCAGTGAATGAGTACTACGAATAGTACTCATTCACTGCAC–3′and 3′–CACGTCACTTACTCATGATGCTTATCATGAGTAAGTGACGTGAAAA–5′. P2X7 shRNA was synthesized by Novobio (Novobio Scientific, Shanghai, P. R. China). When the degree of SGCs confluence was about 90%, transfection was carried out according to the TransIntro EL Transfection Reagent (TransGen Biotech, Beijing, P. R. China) instructions. The optimal ratio was TransIntro™ EL to plasmid = 2:1. Follow-up experiments were performed 24 h after cell transfection.

2.3. The coculture system of DRG neurons and SGCs

The cryopreserved DRG neuronal cell line (Hunan Fenghui Biotechnology Co., Ltd., P. R. China; Cat. no. CL0534) was thawed, then cultured in DMEM medium containing 10% FBS and set aside for use. The isolated SGCs were seeded in transwell chambers and cultured in DMEM/F12 medium containing 10% FBS, and each group was treated accordingly when the cell confluence reached 70%. Then, the neurons were seeded in the lower chamber of transwells and cocultured with SGCs for 24 h. After that, the transwell chamber was removed and the neurons were harvested for subsequent experiments. All cells were cultured in a 37 ℃ cell incubator containing 5% CO₂ in air. The cell line is not listed as a commonly misidentified cell line by the International Cell Line Authentication Committee. A maximum of 15 cell passages was used.

Since the neurons were not treated with drugs, the group followed the SGCs. The neurons were divided into three groups: untreated control; HGHF; HGHF + P2X7 shRNA.

2.4. Real time quantitative PCR (RT–qPCR)

The cells were digested with trypsin to make a suspension. They were harvested by centrifugation, and total RNA was extracted. The RNA was transcribed into cDNA, and the expression of P2X7R in the template was detected according to the requirements of the qPCR kit. The relative expression of P2X7R was detected by the 2^−△△Ct method. Primers were as follows.

P2X7 upstream: 5′–GATGGATGGACCCACAAAGT–3′; downstream: 5′–GCTTCTTTCCCTTCCTCAGC–3′.
TRPV1 upstream: 5′–TTCTGCTCAACATGCTCATFG–3′; downstream: 5′–AATCCTTGAAAACCTCAGC–3′.
β-actin upstream: 5′–CCTAAGGCCAACCGTGAAAAGA–3′; downstream: 5′-GGTACGACCAGAGGCATACA–3′.

We followed the PerfectStart Green qPCR SuperMix (TransGen Biotech, Beijing, P. R. China) instructions for the experiment.

2.5. Western blot analysis

The cells to be treated were washed with PBS. RIPA solution (Biochem; Cat.no.BKM-RA-Q100) was added, and the cells were scraped off and placed into an Eppendorf tube in an ice bath for 30 min. Centrifugation was performed at 4 ℃ for 10 min. Protein loading buffer was added and boiled at 100 ℃ for 5 min. After boiling, samples were loaded at 20 ng/well, and electrophoresis was performed by sodium dodecyl sulfate-polyacrylamide gel 100 V for 2 h. After electrophoresis, protein strips were transferred to polyvinylidene fluoride membranes by electroblotting and placed in 5% bovine serum albumin for 2 h at room temperature, and then incubated at 4 ℃ overnight with the following primary antibodies: rabbit anti‑P2X7 (RRID: AB_2040065; 1:1000; Alomone Labs), rabbit anti‑p65 (1:1000; Cell Signaling Technology; Cat. no. D14E12), rabbit anti‑P-p65 (1:1000; Cell Signaling Technology; Cat. no. S536), rabbit anti‑p38 (1:1000; Cell Signaling Technology; Cat. no. D13E1), rabbit anti‑P-p38 (1:1000; Cell Signaling Technology; Cat. no. D3F9), rabbit anti‑TNF-α (RRID: AB_2811278; 1:800; Boster Biological Technology), rabbit anti‑IL-1β (RRID: AB_2837589; 1:800; Affinity Biosciences), rabbit anti‑TRPV1 (RRID: AB_10857079; 1:1000; Bioss Antibodies), rabbit anti‑PKC-ɛ (1:1000; Proteintech; Cat. no. 20877-1-AP) and mouse anti-β-actin (OriGene Technologies; Cat. no. 18AV0408). The next day, they were washed with TBST and incubated with the following secondary antibodies: goat anti-mouse IgG (RRID: AB_2904507; 1:4000; Boster Biological Technology) and goat anti-rabbit IgG (RRID: AB_2747412; 1:2000; OriGene Technologies). Finally, we used ECL kits (Fdbio science; Cat. no.FD8020) to detect the chemiluminescence signal of the protein, and used Image J software to analyze the gray value of the protein strips.

2.6. Immunofluorescence

The cell slides were washed three times with PBS. The slides were fixed with 4% paraformaldehyde for 15 min and washed three times more with PBS. Then the cells were incubated with 0.3% Triton X-100 at room temperature for 10 min and washed with PBS three times. The slides were sealed with 10% donkey serum (Beijing Solarbio Science and Technology, P. R. China) for 30 min. Diluted rabbit anti‑P2X7 (RRID: AB_2040065; 1:100; Alomone Labs), rabbit anti‑TRPV1 (RRID: AB_10857079; 1:100; Bioss Antibodies), mouse anti-NeuN (RRID: AB_2734601; 1:100; NOVUSBIO) and mouse anti-GFAP (RRID: AB_2294566; 1:100; BioLegend) was added to the cell slides and they were placed into a box and incubated at 4 ℃ overnight. On the second day, the cell slides were rinsed with PBS 3 times. After absorbing excess liquid with absorbent paper, diluted donkey anti-rabbit (RRID: AB_955521; 1:200; Abcam) and donkey anti-mouse (RRID: AB_10675067;1:200; Abcam) was added dropwise and incubated at 37 ℃ for 1.5 h. Then the slides were washed with PBS three times. Finally, an anti-fluorescence quencher was added dropwise, and the images were observed using a fluorescence microscope.

2.7. Enzyme-linked immunosorbent assay (ELISA)

The cell supernatant to be tested was aspirated. According to the tumor necrosis factor-alpha/interleukin-1 beta (TNF-α/IL-1β) ELISA Kit instructions (Camilo, Nanjing, China), standard, test sample, and blank control wells were established. After adding 50 µl of standard sample to the standard well, 10 µl of the test sample and 40 µl of sample diluent was added to the test sample well, and 50 µl of sample diluent was added to the blank control well, and incubated in a 37 ℃ water bath for 35 min. After adding washing solution to each well and resting for 30 s, the washing solution was discarded, and the procedure was repeated five times. Then 50 µl horseradish peroxidase was added to the standard well and sample well (except blank well), then incubated for 30 min at a 37 ℃ water bath, washing solution was added to every well for 30 s, and discarded. Washing was repeated five times. After adding a chromogenic reagent to each well, it was shaken gently and incubated in the dark for 10 min. Finally, the stop solution was added to stop the reaction, and absorbance at 450 nm was detected with a microplate reader.

2.8. Intracellular Ca²⁺ detection

The cells were washed with PBS three times to remove the interference of FBS and phenol red in the medium. The BBcellProbe F03 (Bestbio, Nanjing, P. R. China) solution was diluted 1000 times in a serum-free basal medium and configured as the staining solution. The prepared working solution was added to the cells and incubated at 37 ℃ for 30 min. Then the working solution was discarded and cells were washed with PBS three times, then PBS was added to the cells and incubated at 37 ℃ for 15 min. The excitation wavelength was 488–495 nm, and the emission wavelength was 516 nm. The absorbance was detected with a microplate reader.

2.9. Statistical analysis

All data in this experiment are presented as the mean ± standard deviation (SD). Histograms were drawn using GraphPad Prism v. 5.0 (GraphPad Software Inc., San Diego, CA, USA), IBM SPSS Statistics (v. 21.0; IBM Corp., Armonk, NY, USA) was used for statistical analysis of data in each group, and analysis of variance (ANOVA) was used to evaluate the significance of differences among groups.

3.1 P2X7R expression and activation of SGCs

To investigate the relationship between SGC P2X7R and neuronal TRPV1, we used P2X7 shRNA to knock down the P2X7R and to evaluate subsequent signaling pathways and neuronal TRPV1 changes. The expression of P2X7R was detected by RT–qPCR and western blot analysis (Fig. 1a and Fig. 1b). The levels of P2X7R protein and mRNA in SGCs increased under HGHF induction, while the expression of P2X7R protein and mRNA in SGCs was decreased after transfection with P2X7 shRNA. Thus, HGHF treatment could stimulate SGCs and increase the expression of P2X7R, and SGCs transfected with P2X7 shRNA could knock down P2X7R at the protein and RNA levels.

Glial fibrillary acidic protein (GFAP) is a marker of SGC activation. Under physiological conditions, SGCs are activated by external stimuli, and the expression of GFAP increases. Therefore, we used cell immunofluorescence to detect the expression of GFAP in the four groups (Fig. 1c). As expected, the expression of GFAP in SGCs increased under the HGHF environment, and knockdown of P2X7R with P2X7 shRNA reversed the HGHF-induced increase in GFAP expression. Thus, the HGHF environment could lead to the activation of SGCs, and knockdown of P2X7R could inhibit the activation of SGCs.

Expression of P2X7R and activation of SGCs in each group. (a) The expression of P2X7R protein in SGCs was detected by the western blotting. (b) RT‑qPCR analysis of P2X7 mRNA expression in each group. The expression of P2X7R in SGCs was increased in the HGHF environment (0.6 mM HF/40 mM HG), which was alleviated by SGCs that underwent P2X7 knockdown. The data are shown as the mean ± SD. **P < 0.05, ***P < 0.001 compared with the control group, ^{# #}P < 0.05, ^{# # #}P < 0.001 compared with the HGHF group; n = 3. (c) Expression of GFAP in SGCs in the HGHF environment activated SGCs, resulting in increased GFAP expression, but there was decreased SGCs activation after reducing the expression of P2X7R. GFAP was immunostained using an antibody labeled with fluorescein isothiocyanate (FITC). Scale bar = 50 µm.

3.2 Coexpression of GFAP and P2X7R in SGCs in the HGHF environment

Coexpression of GFAP and P2X7R was detected by immunofluorescence (Fig. 2). The coexpression of GFAP and P2X7R in the control group was substantially reduced compared with the HGHF group. Compared with the HGHF group, the coexpression of GFAP and P2X7R in the HGHF + P2X7 shRNA group was decreased. Thus, immunofluorescence proved that the coexpression of GFAP and P2X7R in SGCs increased in the HGHF conditions, and P2X7 shRNA downregulated the coexpression of P2X7R and GFAP in this environment.

The coexpression of GFAP and P2X7R in SGCs. In response to HGHF (0.6 mM HF/40 mM HG) stimulation, the expressions of both P2X7R and GFAP in SGCs increased, so their coexpression increased. While decreasing the level of P2X7R, the expression of GFAP decreased so their coexpression also decreasing. The green signal indicates GFAP staining with FITC, and P2X7R stained by the antibody labeled with tetramethyl rhodamine isothiocyanate (TRITC). Scale bar = 50 µm.

3.3 Changes of the Ca²⁺/p38 MAPK/NF-κB signaling pathway in SGCs

P2X7R is an ion receptor that achieves cellular signal transduction by mediating ion flow inside and outside cells. Knockdown of P2X7R could prevent such ion exchange, thereby inhibiting the activation of certain signaling pathways. Therefore, we used the BBcellProbe F03 method to detect the intracellular Ca²⁺ content of SGCs (Fig. 3a). We found that the increased expression of P2X7R in SGCs led to an increase in intracellular Ca²⁺ in a HGHF environment, while the content of intracellular Ca²⁺ decreased after inhibition of P2X7R expression. Intracellular Ca²⁺ concentration plays a crucial role in regulating cell proliferation and apoptosis, and could affect the activation of p38 mitogen-activated protein kinase (MAPK) [26, 50]. We used western blot analysis to detect the expression of p38 (Fig. 3b) and phsopho-p38 (P-p38) (Fig. 3c) in SGCs. The results showed that HGHF could induce the activation of p38 MAPK pathway in SGCs, and knockdown of P2X7R could reduce the activation of p38 MAPK pathway by inhibiting the influx of Ca²⁺.

Nuclear factor kappa-B (NF-κB) is a downstream signaling molecule of p38 MAPK. When cells are stimulated, the p38 MAPK signaling pathway promotes the degradation and phosphorylation of IκBα, releases and activates the NF-κB dimer, and thus activates the NF-κB pathway[29, 53]. Here, the expression of P65 (Fig. 3d) and phsopho-p65 (P-p65) (Fig. 3e) in SGCs was detected by western blotting. Thus, the NF-κB pathway of SGCs was activated in the HGHF environment, and inhibition of P2X7R could alleviate the HGHF-induced NF-κB pathway activation. Hence, inhibition of P2X7R could reduce activation of the Ca²⁺/p38 MAPK/NF-κB signaling pathway in SGCs.

Changes of the Ca²⁺/p38 MAPK/NF-κB signaling pathway in SGCs in each group. (a) The BBcellProbe F03 method was used to detect the intracellular Ca²⁺ content of SGCs. (b, c) The expression levels of p38 and P-p38 in SGCs were detected using western blotting. (d, e) Detection of the levels of P65 and P-p65 in SGCs using western blotting. The decreased expression of P2X7R in SGCs reduced Ca²⁺ influx, thereby alleviating activation of P38 MAPK and NF-κB pathways stimulated by HGHF (0.6 mM HF/40 mM HG). The data results show the mean ± SD. **P < 0.05, ***P < 0.001 compared with the control group; ^{# #}P < 0.05, ^{# # #}P < 0.001 compared with the HGHF group; n = 3.

3.4 Expression of TNF-α and IL-1β in SGC in the HGHF environment

Studies have shown that p38 MAPK can regulate the expression of IL-1β and TNF-α in cells via NF-κB, and that inhibition of p38 MAPK can decrease the activity of NF-κB and reduce the production of inflammatory factors[25, 28, 32]. Therefore, we used western blotting to detect the expression of inflammatory factors IL-1β (Fig. 4a) and TNF-α (Fig. 4b) in SGCs. The membrane of the transwell chamber allows inflammatory cytokines released by SGCs to pass through, thereby affecting neurons, so we used ELISA to detect the content of IL-1β (Fig. 4c) and TNF-α (Fig. 4d) in the culture supernatant of SGCs in each group. Our results indicate that the HGHF environment could induce an inflammatory response in SGCs and activate the Ca²⁺/p38 MAPK/NF-κB signaling pathway to increase the release of IL-1β and TNF-α. However, inhibition of P2X7R could inhibit the activation of SGCs and the release of inflammatory factors via the Ca²⁺/p38 MAPK/NF-κB pathway.

Expression and release of inflammatory factors TNF-α and IL-1β in SGCs in each group. (a, b) The expression of SGCs inflammatory cytokines TNF-α and IL-1β in the HGHF environment (0.6 mM HF/40 mM HG) was detected by western blotting. (c, d) The release levels of inflammatory factors IL-1β and TNF-α in SGCs. The increased release of inflammatory factors is another marker of the activation of SGCs. The activation of SGCs after stimulation eventually leads to the release of inflammatory factors, while the reduction of P2X7R expression alleviates the activation of SGCs, and finally inhibits the release of inflammatory factors. The data are shown as the mean ± SD. **P < 0.05, ***P < 0.001 compared with the control group, ^{# #}P < 0.05, ^{# # #}P < 0.001 compared with the HGHF group; n = 3.

3.5 Expression of TRPV1 in neurons after coculture with SGCs

Our previous studies have demonstrated that SGCs P2X7R may regulate the release of inflammatory factors, and some studies have shown that the activation of TRPV1 is related to extracellular inflammatory factors[12, 39]. Therefore, we cocultured neurons and SGCs to explore the effect of cytokines released on neuronal TRPV1. Neurons were collected after 24 h of coculture with SGCs, and the expression of TRPV1 in neurons was detected by western blotting (Fig. 5a) and RT‑qPCR (Fig. 5b). The results show that the release of inflammatory factors from SGCs induced by HGHF may lead to increases in the levels of TRPV1 protein and mRNA. However, after coculture with SGCs with the P2X7R knocked down, the levels of TRPV1 protein and mRNA in neurons decreased. Neuronal nuclei (NeuN) is a specific marker of neurons. The coexpression of TRPV1 and NeuN in neurons was detected by immunofluorescence (Fig. 5c). Inflammatory factors released by SGCs in HGHF environment could increase the coexpression of TRPV1 and NeuN in neurons. On the other hand, inhibition of P2X7R expression in SGCs can reduce the co-expression of TRPV1 and NeuN in neurons by reducing the release of inflammatory factors from SGCs. These results indicate that TRPV1 is expressed in neurons and the reduction of extracellular inflammatory factors could reduce the expression of TRPV1. Expression levels of TRPV1 in neurons after coculture with SGCs was defined as the primary endpoint of this study.

3.6 Changes of the Ca ²⁺ / PKC-ɛ / p38 MAPK signaling pathway in neurons after coculture with SGCs

Cytokines play important roles in communication between neurons and glial cells, and glial cells release inflammatory cytokines when stimulated. An inflammatory environment could increase the levels of Ca²⁺ in neurons[54]. Therefore, we detected the intracellular Ca²⁺ content of neurons in each group after coculture (Fig. 6a). The results showed that the intracellular Ca²⁺ content of neurons cocultured with SGCs of the HGHF group increased, while the intracellular Ca²⁺ content of neurons cocultured with SGCs of the P2X7 shRNA group decreased. Protein kinase C-epsilon (PKC-ɛ) is Ca²⁺-dependent that associated with cytokine-induced activation of primary nociceptive receptors, so we detected the expression levels of PKC-ɛ in neurons after coculture by western blotting (Fig. 6b). The results demonstrated that the increase of Ca²⁺ in neurons could activate PKC-ɛ, and the activation of PKC-ɛ decreased after neurons were cocultured with P2X7R-knockdown SGCs. PKC-ɛ is closely related to p38 MAPK in the generation and development of pain, and previous studies have shown that PKC-ɛ is the upstream signaling molecule of p38 MAPK[63]. Therefore, we detected the expression of p38 (Fig. 6c) and P-p38 (Fig. 6d) in neurons after coculture by western blotting. The results showed that the activation of PKC-ɛ could indeed affect the activation of p38 MAPK.

SGCs are distributed around the DRG neurons, and the larger the body of the neuron, the more SGCs present[11, 42]. GFAP is a specific marker of activation of central astrocytes and peripheral SGCs, and studies have shown that SGCs could be activated under pathological conditions such as nerve injury and inflammation, and the proliferation of SGCs, the expression of GFAP and the increase of gap junctions were the main manifestations[16, 30]. Activated SGCs regulate the excitability of DRG neurons and participate in peripheral pain sensitization through gap junctions[20, 46], proving that the activation of SGCs is related to the occurrence and maintenance of pain. P2X7R is involved in cytokine release, and activating the P2X7R on glial cells leads to the formation of the NLRP3 inflammasome, which forms caspase 1 and ultimately leads to IL-1β release[34, 55]. After stimulation, sensory neurons may release ATP and activate the P2X7R on glial cells to promote the opening and formation of plasma membrane pores and increase the release of cytokines such as TNF-α and plasminogen[24, 37]. Therefore, excitation of P2X7R may activate SGCs and augment the release of inflammatory factors from SGCs to induce chronic pain[5, 58]. We used an HGHF cell culture environment to simulate the living environment of cells under conditions of diabetes. We found that the expression of GFAP and the levels of TNF-α and IL-1β in SGCs were enhanced under the HGHF environment, which proved that SGCs could be activated by HGHF.

The NF-κB and p38 MAPK signaling pathways play vital roles in autoimmune diseases and chronic inflammation[23, 61, 71]. Activation of P2X7R has been shown to stimulate the phosphorylation of cell signaling molecules, such as p38 MAPK and extracellular regulated protein kinase, thereby triggering the activation of nuclear factor NF-κB[15, 49, 56]. Gallic acid could reduce hyperalgesia in CCI rats by downregulating the P2X7R, reducing the activation of SGCs in DRG and inhibiting the NF-κB/STAT3 signaling pathway[70]. Here, we used P2X7 shRNA to knock down the P2X7R in SGCs. This could significantly reduce the elevated P-p38 and P-p65 expression induced by an HGHF environment, thus demonstrating that reducing P2X7R in SGCs may effectively inhibit the activation of the p38MAPK/NF-κB signaling pathway.

Downregulation of P2X7R could reduce the release of inflammatory factors[72], and blockade of P2X7R with Brilliant Blue G could inhibit NF-κB and MAPK signaling pathways, downregulate the expression of TNF-α, IL-16 and IL-1β, and inhibit lipopolysaccharides-induced inflammation in BV2 cells[60, 65]. Inflammatory mediators may cause the DRG to release ATP, which activates the P2X7R on SGCs and triggers the release of IL-1β[41]. Cilnidipine could reduce the transmission of Ca²⁺ and the expression of IL-1β by inhibiting the P2X7R of microglia, thereby alleviating neuropathic pain[69], at the same time, our experimental results also show that inhibition of P2X7R may reduce the content of intracellular Ca²⁺. Here, knockdown of the P2X7R with P2X7 shRNA significantly inhibited the release of TNF-α and IL-1β in SGCs under the HGHF environment. Based on the above studies and our experimental results, we speculate that an HGHF environment could induce the upregulation of P2X7R expression and the increase of inflammatory factors TNF-α and IL-1β, and inhibition of P2X7R could reduce the release of inflammatory factors via Ca2+/p38 MAPK/NF-κB signaling pathway in SGCs.

Neurons and glial cells could transmit information through inflammatory factors and the P2X7R regulates IL-1β release during peripheral hyperalgesia and plays a role in neuron–glial cell communication. Some studies have also found that the release of TNF-α mediated by the P2X7R of SGCs enhances the discharge of the action potential of the cell body and has an excitatory effect on DRG neurons[13]. TRPV1 could be activated in an inflammatory environment, and studies have shown that extracellular inflammatory factors such as TNF-α and IL-1β may affect the activation of TRPV1[12, 39]. At the same time, our study showed that activation of SGCs resulted in increased release of inflammatory factors in SGCs and increased expression of neuronal TRPV1, while inhibition of P2X7R in SGCs resulted in decreased release of inflammatory factors in SGCs and ultimately reduced expression of neuronal TRPV1.

Stimulating DRG with IL-1β and TNF-α may increase intracellular Ca²⁺ in neurons, reduce the threshold current of action potentials and trigger spontaneous firing of DRG neurons, thus causing neurons to excite[54]. P2X7R could regulate Ca²⁺ concentration in SGCs, while P2X7R inhibitors could inhibit bidirectional Ca²⁺ communication between SGCs and neurons[64]. We found that the intracellular Ca²⁺ of SGCs increased after HGHF treatment. In contrast, the Ca²⁺ levels of SGCs transfected with P2X7 shRNA was decreased. After coculture of neurons and SGCs, the intracellular Ca²⁺ of neurons in the HGHF group heightened compared with the control group. In contrast, the intracellular Ca²⁺ was decreased in neurons cocultured with SGCs transfected with P2X7 shRNA. These results suggest that stimulation of SGCs could lead to the increase of intracellular Ca²⁺, and the P2X7R may regulate intracellular Ca²⁺. Inflammatory factors released by cocultured SGCs could activate neurons, while P2X7R could affect neurons by regulating the release inflammatory factors.

PKC-ε, one of the subtypes of PKC, is Ca²⁺-dependent, and could mediate cytokine-induced nociceptor receptor activation in primary nociceptors and induce intracellular-related signaling pathways[17, 36, 67]. Our experimental results also showed that the neurons intracellular Ca²⁺ was increased and PKC-ε was activated in neurons after coculture with neurons and HGHF-induced SGCs. On the other hand, inhibition of P2X7R of SGCs could decrease the concentration of intracellular Ca²⁺ and inhibit the activity of PKC-ε in neurons. Studies have shown that blocking p38 MAPK does not affect PKC-ɛ phosphorylation, whereas blocking PKC-ɛ abolishes phosphorylation of p38 MAPK[31, 63]. Therefore, p38 MAPK was identified as a downstream target of PKC-ɛ. Our study also proved that the PKC-ɛ pathway was activated by neuronal Ca²⁺, the expression of P-p38 was increased, so the p38 MAPK pathway was activated. TRPV1 is generally considered to downstream of PKC signaling and is associated with pain behavior, and inhibition of PKC may attenuate pain by disrupting the phosphorylation sites of TRPV1[62]. TRPV1 is associated with the activation of p38 MAPK in primary sensory neurons, and activation of p38 MAPK in the DRG increases the expression of TRPV1 in the peripheral nociceptor, ultimately leading to inflammatory pain[19]. Studies have shown that p38 MAPK has a role in regulating TRPV1 expression in DRG neurons, and the use of p38 MAPK inhibitors in DRG neurons could block TRPV1 activation but does not reduce local inflammation[22]. In our experiments, TRPV1 expression increased after p38MAPK activation. We speculate that sensitization of SGCs may activate the Ca²⁺/PKC-ɛ/p38 MAPK signaling pathway in neurons through the increased release of inflammatory factors in SGCs, resulting in increased TRPV1 expression. However, knockdown of P2X7R was inhibited the release of inflammatory factors in SGCs, which inhibited the activation of the neuronal Ca²⁺/PKC-ɛ/p38 MAPK signaling pathway, and ultimately decreased the expression of TRPV1.Therefore, our results suggest that a decrease of extracellular inflammatory cytokines may reduce neuronal TRPV1 expression through the Ca²⁺/PKC-ɛ/p38 MAPK pathway.

In summary, we speculate that HGHF could induce activation of SGCs and increase the release of inflammatory factors, which may up-regulate the expression of TRPV1 on neurons under coculture conditions with SGCs; conversely, knockdown of P2X7R in SGCs could reduce the release of inflammatory factors from SGCs by inhibiting the Ca²⁺/p38 MAPK/NF-κB signaling pathway, which inhibiting the neuronal Ca²⁺/PKC-ɛ/p38 MAPK signaling pathway to decrease in the expression of TRPV1 on neurons under coculture conditions with SGCs.

DRG Dorsal root ganglion

GFAP Glial fibrillary acidic protein

HGHF High glucose and high free-fat

IL-1β Interleukin-1 beta

MAPK Mitogen-activated protein kinase

NPP Neuropathic pain

NF-kB Nuclear factor kappa-B

NeuN Neuronal nuclei

P2X7R The purinergic 2X7 receptor

PBS Phosphate-buffered saline

PKC-ɛ Protein kinase C-epsilon

SGC Satellite glial cell

shRNA short hairpin RNA

TRPV1 Transient receptor potential vanilloid type 1

TNF-a Tumor necrosis factor-alpha

Statements and Declarations

Funding

This work was supported by the grant from the National Natural Science Foundation of China (No. 82060247), the grant from Natural Science Foundation of Jiangxi Province (No. 20202BAB206027), and grants from high level and high skilled leading talents training project of Jiangxi Province in 2021 (No. 2022233071 Jiangxi Province Human Resources and Social Security Department).

Competing Interests

The author declares no competing financial interest.

Author Contributions

Changshui Xu and Hongji Wang designed the study; Hongji Wang performed experiments and wrote the manuscript; Lisha Chen, Juping Xing and Xiangchao Shi analyzed data.

Data Availability

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Ethical Approval

The present study was approved by the Ethical Committee of Nanchang University and animals were treated according to the Guidelines for the Care and Use of Animals.

Consent to Participate

Not applicable.

Consent for Publication

Yes, all the authors have given their consent for the publication of this manuscript in its present form.

Acknowledgements

The authors thank the Department of Physiology of Nanchang University for technical assistance.

Arribas-Blázquez M, Olivos-Oré LA, Barahona MV, Muela MSdl, Solar V et al (2019) Overexpression of P2X3 and P2X7 Receptors and TRPV1 Channels in Adrenomedullary Chromaffin Cells in a Rat Model of Neuropathic Pain. J Int J Mol Sci 20(1). doi:10.3390/ijms20010155
Bernier LP, Ase AR, Seguela P (2018) P2X receptor channels in chronic pain pathways. Br J Pharmacol 175(12):2219–2230. doi:10.1111/bph.13957
Carrasco C, Naziroglu M, Rodriguez AB, Pariente JA (2018) Neuropathic Pain: Delving into the Oxidative Origin and the Possible Implication of Transient Receptor Potential Channels. Front Physiol 9:95. doi:10.3389/fphys.2018.00095
Chung MK, Campbell JN (2016) Use of Capsaicin to Treat Pain: Mechanistic and Therapeutic Considerations. Pharmaceuticals (Basel) 9(4). doi:10.3390/ph9040066
Donnelly-Roberts DL, Jarvis MF (2007) Discovery of P2X7 receptor-selective antagonists offers new insights into P2X7 receptor function and indicates a role in chronic pain states. Br J Pharmacol 151(5):571–579. doi:10.1038/sj.bjp.0707265
Donnelly CR, Andriessen AS, Chen G, Wang K, Jiang C et al (2020) Central Nervous System Targets: Glial Cell Mechanisms in Chronic Pain. Neurotherapeutics 17(3):846–860. doi:10.1007/s13311-020-00905-7
Duo L, Hu L, Tian N, Cheng G, Wang H et al (2018) TRPV1 gain-of-function mutation impairs pain and itch sensations in mice. Mol Pain 14:1744806918762031. doi:10.1177/1744806918762031
Finnerup NB, Kuner R, Jensen TS (2021) Neuropathic Pain: From Mechanisms to Treatment. Physiol Rev 101(1):259–301. doi:10.1152/physrev.00045.2019
Fujii T, Yamasaki R, Kira JI (2019) Novel Neuropathic Pain Mechanisms Associated With Allergic Inflammation. Front Neurol 10:1337. doi:10.3389/fneur.2019.01337
Galicia-Garcia U, Benito-Vicente A, Jebari S, Larrea-Sebal A, Siddiqi H et al (2020) Pathophysiology of Type 2 Diabetes Mellitus. Int J Mol Sci 21(17). doi:10.3390/ijms21176275
Gazerani P (2021) Satellite Glial Cells in Pain Research: A Targeted Viewpoint of Potential and Future Directions. Front Pain Res (Lausanne) 2:646068. doi:10.3389/fpain.2021.646068
Gouin O, L'Herondelle K, Lebonvallet N, Le Gall-Ianotto C, Sakka M et al (2017) TRPV1 and TRPA1 in cutaneous neurogenic and chronic inflammation: pro-inflammatory response induced by their activation and their sensitization. Protein Cell 8(9):644–661. doi:10.1007/s13238-017-0395-5
Gu Y, Chen Y, Zhang X, Li GW, Wang C et al (2010) Neuronal soma-satellite glial cell interactions in sensory ganglia and the participation of purinergic receptors. Neuron Glia Biol 6(1):53–62. doi:10.1017/S1740925X10000116
Guo SH, Lin JP, Huang LE, Yang Y, Chen CQ et al (2019) Silencing of spinal Trpv1 attenuates neuropathic pain in rats by inhibiting CAMKII expression and ERK2 phosphorylation. Sci Rep 9(1):2769. doi:10.1038/s41598-019-39184-4
Guo Y, Xu X, Huang J, Wang Z, Li Z et al (2020) The Actions and Mechanisms of P2X7R and p38 MAPK Activation in Mediating Bortezomib-Induced Neuropathic Pain. Biomed Res Int, 2020:8143754.doi:10.1155/2020/8143754
Hanani M (2022) How Is Peripheral Injury Signaled to Satellite Glial Cells in Sensory Ganglia? Cells 11(3). doi:10.3390/cells11030512
He Y, Wang ZJ (2015) Nociceptor beta II, delta, and epsilon isoforms of PKC differentially mediate paclitaxel-induced spontaneous and evoked pain. J Neurosci 35(11):4614–4625. doi:10.1523/JNEUROSCI.1580-14.2015
Himanshu D, Ali W, Wamique M (2020) Type 2 diabetes mellitus: pathogenesis and genetic diagnosis. J Diabetes Metabolic Disorders 19(2):1959–1966. doi:10.1007/s40200-020-00641-x
Holland S, Coste O, Zhang DD, Pierre SC, Geisslinger G et al (2011) The ubiquitin ligase MYCBP2 regulates transient receptor potential vanilloid receptor 1 (TRPV1) internalization through inhibition of p38 MAPK signaling. J Biol Chem 286(5):3671–3680. doi:10.1074/jbc.M110.154765
Huang LY, Gu Y, Chen Y (2013) Communication between neuronal somata and satellite glial cells in sensory ganglia. Glia 61(10):1571–1581. doi:10.1002/glia.22541
Illes P (2020) P2X7 Receptors Amplify CNS Damage in Neurodegenerative Diseases. Int J Mol Sci 21(17). doi:10.3390/ijms21175996
Ji RR, Samad TA, Jin SX, Schmoll R, Woolf CJ (2002) p38 MAPK activation by NGF in primary sensory neurons after inflammation increases TRPV1 levels and maintains heat hyperalgesia. Neuron 36(1):57–68. doi:10.1016/s0896-6273(02)00908-x
Ji RR, Suter MR (2007) p38 MAPK, microglial signaling, and neuropathic pain. Mol Pain 3:33. doi:10.1186/1744-8069-3-33
Jiang LH, Caseley EA, Muench SP, Roger S (2021) Structural basis for the functional properties of the P2X7 receptor for extracellular ATP. Purinergic Signal 17(3):331–344. doi:10.1007/s11302-021-09790-x
Jiang R, Liao J, Yang MC, Deng J, Hu YX et al (2020) Lidocaine mediates the progression of cerebral ischemia/reperfusion injury in rats via inhibiting the activation of NF-kappaB p65 and p38 MAPK. Ann Transl Med 8(8):548. doi:10.21037/atm-20-3066
Jiang Y, Fang Y, Ye Y, Xu X, Wang B et al (2019) Anti-Cancer Effects of 3, 3'-Diindolylmethane on Human Hepatocellular Carcinoma Cells Is Enhanced by Calcium Ionophore: The Role of Cytosolic Ca(2+) and p38 MAPK. Front Pharmacol 10:1167. doi:10.3389/fphar.2019.01167
Kanellopoulos JM, Delarasse C (2019) Pleiotropic Roles of P2X7 in the Central Nervous System. Front Cell Neurosci 13. doi:10.3389/fncel.2019.00401
Ke J, Cai G (2021) Effect of IL-33 on pyroptosis of macrophages in mice with sepsis via NF-kappaB/p38 MAPK signaling pathway. Acta Cir Bras 36(5):e360501. doi:10.1590/ACB360501
Lee H, Jang JH, Kim SJ (2021) Malonic acid suppresses lipopolysaccharide-induced BV2 microglia cell activation by inhibiting the p38 MAPK/NF-kappaB pathway. Anim Cells Syst (Seoul) 25(2):110–118. doi:10.1080/19768354.2021.1901781
Lee JH, Kim W (2020) The Role of Satellite Glial Cells, Astrocytes, and Microglia in Oxaliplatin-Induced Neuropathic Pain. Biomedicines 8(9). doi:10.3390/biomedicines8090324
Li NQ, Peng Z, Xu WW, An K, Wan L (2021) Bone mesenchymal stem cells attenuate resiniferatoxin-induced neuralgia via inhibiting TRPA1-PKCdelta-P38/MAPK-p-P65 pathway in mice. Brain Res Bull 174:92–102. doi:10.1016/j.brainresbull.2021.06.004
Li Q, Cheng F, Zhou K, Fang L, Wu J et al (2021) Increased sensitivity to TNF-alpha promotes keloid fibroblast hyperproliferation by activating the NF-kappaB, JNK and p38 MAPK pathways. Exp Ther Med 21(5):502. doi:10.3892/etm.2021.9933
Liu CL, Deng ZY, Du ER, Xu CS (2018) Long non–coding RNA BC168687 small interfering RNA reduces high glucose and high free fatty acid–induced expression of P2X7 receptors in satellite glial cells. Mol Med Rep 17(4):5851–5859. doi:10.3892/mmr.2018.8601
Luchting B, Heyn J, Woehrle T, Rachinger-Adam B, Kreth S et al (2016) Differential expression of P2X7 receptor and IL-1beta in nociceptive and neuropathic pain. J Neuroinflammation 13(1):100. doi:10.1186/s12974-016-0565-z
Luo J, Bavencoffe A, Yang P, Feng J, Yin S et al (2018) Zinc Inhibits TRPV1 to Alleviate Chemotherapy-Induced Neuropathic Pain. J Neurosci 38(2):474–483. doi:10.1523/jneurosci.1816-17.2017
M C et al (2003) PKC epsilon is involved in JNK activation that mediates LPSinduced TNF-␣, which induces apoptosis in macrophages. Am J Physiol Cell Physiol 285(5). doi:10.1152/ajpcell.00228.2003
Martinez-Cuesta MA, Blanch-Ruiz MA, Ortega-Luna R, Sanchez-Lopez A, Alvarez A (2020) Structural and Functional Basis for Understanding the Biological Significance of P2X7 Receptor. Int J Mol Sci 21(22). doi:10.3390/ijms21228454
Moore C, Gupta R, Jordt SE, Chen Y, Liedtke WB (2018) Regulation of Pain and Itch by TRP Channels. Neurosci Bull 34(1):120–142. doi:10.1007/s12264-017-0200-8
Munjuluri S, Wilkerson DA, Sooch G, Chen X, White FA et al (2021) Capsaicin and TRPV1 Channels in the Cardiovascular System: The Role of Inflammation. Cells 11(1). doi:10.3390/cells11010018
Naziroglu M, Oz A, Yildizhan K (2020) Selenium and Neurological Diseases: Focus on Peripheral Pain and TRP Channels. Curr Neuropharmacol 18(6):501–517. doi:10.2174/1570159X18666200106152631
Neves AF, Farias FH, de Magalhães SF, Araldi D, Pagliusi M Jr et al (2020) Peripheral Inflammatory Hyperalgesia Depends on P2X7 Receptors in Satellite Glial Cells. Front Physiol 11:473. doi:10.3389/fphys.2020.00473
Ohara PT, Vit JP, Bhargava A, Romero M, Sundberg C et al (2009) Gliopathic pain: when satellite glial cells go bad. Neuroscientist 15(5):450–463. doi:10.1177/1073858409336094
Pecze L, Viskolcz B, Olah Z (2017) Molecular Surgery Concept from Bench to Bedside: A Focus on TRPV1 + Pain-Sensing Neurons. Front Physiol 8:378. doi:10.3389/fphys.2017.00378
Rachdaoui N (2020) Insulin: The Friend and the Foe in the Development of Type 2 Diabetes Mellitus. Int J Mol Sci 21(5). doi:10.3390/ijms21051770
Ren WJ, Illes P (2022) Involvement of P2X7 receptors in chronic pain disorders. Purinergic Signal 18(1):83–92. doi:10.1007/s11302-021-09796-5
Retamal MA, Riquelme MA, Stehberg J, Alcayaga J (2017) Connexin43 Hemichannels in Satellite Glial Cells, Can They Influence Sensory Neuron Activity? Front Mol Neurosci 10:374. doi:10.3389/fnmol.2017.00374
Rosenberger DC, Blechschmidt V, Timmerman H, Wolff A, Treede RD (2020) Challenges of neuropathic pain: focus on diabetic neuropathy. J Neural Transm (Vienna) 127(4):589–624. doi:10.1007/s00702-020-02145-7
Rotondo JC, Mazziotta C, Lanzillotti C, Stefani C, Badiale G et al (2022) The Role of Purinergic P2X7 Receptor in Inflammation and Cancer: Novel Molecular Insights and Clinical Applications. Cancers (Basel) 14(5). doi:10.3390/cancers14051116
Salahuddin MM, Omran GA, Helmy MW, Houssen ME (2021) Effect of Regorafenib on P2X7 Receptor Expression and Different Oncogenic Signaling Pathways in a Human Breast Cancer Cell Line: A Potential of New Insight of the Antitumor Effects of Regorafenib. Curr Issues Mol Biol 43(3):2199–2209. doi:10.3390/cimb43030154
Sanchez AB, Medders KE, Maung R, Sanchez-Pavon P, Ojeda-Juarez D et al (2016) CXCL12-induced neurotoxicity critically depends on NMDA receptor-gated and L-type Ca(2+) channels upstream of p38 MAPK. J Neuroinflammation 13(1):252. doi:10.1186/s12974-016-0724-2
Schomberg D, Ahmed M, Miranpuri G, Olson J, Resnick DK (2012) Neuropathic pain: role of inflammation, immune response, and ion channel activity in central injury mechanisms. Ann Neurosci 19(3):125–132. doi:10.5214/ans.0972.7531.190309
Shan W, Liao X, Tang Y, Liu J (2021) Dexmedetomidine alleviates inflammation in neuropathic pain by suppressing NLRP3 via Nrf2 activation. Exp Ther Med 22(4):1046doi. 10.3892/etm.2021.10479
Shih JH, Tsai YF, Li IH, Chen MH, Huang YS (2020) Hp-s1 Ganglioside Suppresses Proinflammatory Responses by Inhibiting MyD88-Dependent NF-kappaB and JNK/p38 MAPK Pathways in Lipopolysaccharide-Stimulated Microglial Cells. Mar Drugs 18(10). doi:10.3390/md18100496
Song DD, Li Y, Tang D, Huang LY, Yuan YZ (2014) Neuron-glial communication mediated by TNF-alpha and glial activation in dorsal root ganglia in visceral inflammatory hypersensitivity. Am J Physiol Gastrointest Liver Physiol 306(9):G788–795. doi:10.1152/ajpgi.00318.2013
Thawkar BS, Kaur G (2018) Inhibitors of NF-κB and P2X7/NLRP3/Caspase 1 pathway in microglia: Novel therapeutic opportunities in neuroinflammation induced early-stage Alzheimer’s disease %J. Journal of Neuroimmunology
Thomas LM, Salter RD (2010) Activation of macrophages by P2X7-induced microvesicles from myeloid cells is mediated by phospholipids and is partially dependent on TLR4. J Immunol 185(6):3740–3749. doi:10.4049/jimmunol.1001231
Tiwari V, Guan Y, Raja SN (2014) Modulating the delicate glial-neuronal interactions in neuropathic pain: promises and potential caveats. Neurosci Biobehav Rev 45:19–27. doi:10.1016/j.neubiorev.2014.05.002
Trang T, Beggs S, Salter MW (2012) ATP receptors gate microglia signaling in neuropathic pain. Exp Neurol 234(2):354–361. doi:10.1016/j.expneurol.2011.11.012
Wang C, Gu L, Ruan Y, Gegen T, Yu L et al (2018) Pirt Together with TRPV1 Is Involved in the Regulation of Neuropathic Pain. Neural Plast, 2018:4861491.doi:10.1155/2018/4861491
Wang W, Huang F, Jiang W, Wang W, Xiang J (2020) Brilliant blue G attenuates neuro-inflammation via regulating MAPKs and NF-kappaB signaling pathways in lipopolysaccharide-induced BV2 microglia cells. Exp Ther Med 20(5):116. doi:10.3892/etm.2020.9244
Wang X, Liu Q (2021) Dexmedetomidine relieved neuropathic pain and inflammation response induced by CCI through HMGB1/TLR4/NF-kappaB signal pathway. Biol Pharm Bull. doi:10.1248/bpb.b21-00329
Wang Y, Gao Y, Tian Q, Deng Q, Wang Y et al (2018) TRPV1 SUMOylation regulates nociceptive signaling in models of inflammatory pain. Nat Commun 9(1):1529. doi:10.1038/s41467-018-03974-7
Weber NC, Toma O, Wolter JI, Obal D, Mullenheim J et al (2005) The noble gas xenon induces pharmacological preconditioning in the rat heart in vivo via induction of PKC-epsilon and p38 MAPK. Br J Pharmacol 144(1):123–132. doi:10.1038/sj.bjp.0706063
X., Z., Y., C., C., W., & LY., H. Neuronal somatic ATP release triggers neuron-satellite glial cell communication in dorsal root ganglia.Proc Natl Acad Sci U S A, 104(23):9864–9869.doi:doi:10.1073/pnas.0611048104
Xiang HC, Lin LX, Hu XF, Zhu H, Li HP et al (2019) AMPK activation attenuates inflammatory pain through inhibiting NF-kappaB activation and IL-1beta expression. J Neuroinflammation 16(1):34. doi:10.1186/s12974-019-1411-x
Xu H, He L, Liu C, Tang L, Xu Y et al (2016) LncRNA NONRATT021972 siRNA attenuates P2X7 receptor expression and inflammatory cytokine production induced by combined high glucose and free fatty acids in PC12 cells. Purinergic Signal 12(2):259–268. doi:10.1007/s11302-016-9500-0
Y A (2002) Protein kinase C-epsilon (PKC-epsilon): its unique structure and function. J Biochem 132(6):847–852. doi:10.1093/oxfordjournals.jbchem.a003296
Yamasaki R, Fujii T, Wang B, Masaki K, Kido MA et al (2016) Allergic Inflammation Leads to Neuropathic Pain via Glial Cell Activation. J Neurosci 36(47):11929–11945. doi:10.1523/JNEUROSCI.1981-16.2016
Yamashita T, Kamikaseda S, Tanaka A, Tozaki-Saitoh H, Caaveiro JMM et al (2021) New Inhibitory Effects of Cilnidipine on Microglial P2X7 Receptors and IL-1beta Release: An Involvement in its Alleviating Effect on Neuropathic Pain. Cells, 10(2).doi:10.3390/cells10020434
Yang R, Li Z, Zou Y, Yang J, Li L et al (2021) Gallic Acid Alleviates Neuropathic Pain Behaviors in Rats by Inhibiting P2X7 Receptor-Mediated NF-kappaB/STAT3 Signaling Pathway. Front Pharmacol 12:680139. doi:10.3389/fphar.2021.680139
Yang Y, Zhou W, Xu X, Ge X, Wang F et al (2021) Aprepitant Inhibits JNK and p38/MAPK to Attenuate Inflammation and Suppresses Inflammatory Pain. Front Pharmacol 12:811584. doi:10.3389/fphar.2021.811584
Yue N, Huang H, Zhu X, Han Q, Wang Y et al (2017) Activation of P2X7 receptor and NLRP3 inflammasome assembly in hippocampal glial cells mediates chronic stress-induced depressive-like behaviors. J Neuroinflammation 14(1):102. doi:10.1186/s12974-017-0865-y
Zhang BY, Zhang YL, Sun Q, Zhang PA, Wang XX et al (2020) Alpha-lipoic acid downregulates TRPV1 receptor via NF-kappaB and attenuates neuropathic pain in rats with diabetes. CNS Neurosci Ther 26(7):762–772. doi:10.1111/cns.13303

floatimage1.jpeg
Graphical Abstract Rat satellite glial cells were activated by a high-glucose and high free-fat environment, which upregulated P2X7R and led to the release of inflammatory factors via the Ca²⁺/p38 MAPK/NF-kB signaling pathway. Upregulated P2X7R could induce the release of inflammatory factors in satellite glial cells, which acted on neurons and upregulated neuronal TRPV1 expression via the Ca²⁺/ PKC-ɛ / p38 MAPK signaling pathway, while knockdown of P2X7R with P2X7 shRNA downregulated TRPV1 expression on neurons.

Download PDF

Version 1

posted

You are reading this latest preprint version

Inhibition of P2X7 receptor downregulates neuronal TRPV1 expression in rat dorsal root ganglion

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods

2.1. Primary culture

2.2. Construction and transfection of the P2X7 shRNA expression vector

2.3. The coculture system of DRG neurons and SGCs

2.4. Real time quantitative PCR (RT–qPCR)

2.5. Western blot analysis

2.6. Immunofluorescence

2.7. Enzyme-linked immunosorbent assay (ELISA)

2.8. Intracellular Ca²⁺ detection

2.9. Statistical analysis

3. Results

3.1 P2X7R expression and activation of SGCs

3.2 Coexpression of GFAP and P2X7R in SGCs in the HGHF environment

3.3 Changes of the Ca²⁺/p38 MAPK/NF-κB signaling pathway in SGCs

3.4 Expression of TNF-α and IL-1β in SGC in the HGHF environment

3.5 Expression of TRPV1 in neurons after coculture with SGCs

4. Discussion

5. Conclusions

Abbreviations

Declarations

References

Supplementary Files

Status:

Version 1

Inhibition of P2X7 receptor downregulates neuronal TRPV1 expression in rat dorsal root ganglion

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods

2.1. Primary culture

2.2. Construction and transfection of the P2X7 shRNA expression vector

2.3. The coculture system of DRG neurons and SGCs

2.4. Real time quantitative PCR (RT–qPCR)

2.5. Western blot analysis

2.6. Immunofluorescence

2.7. Enzyme-linked immunosorbent assay (ELISA)

2.8. Intracellular Ca2+ detection

2.9. Statistical analysis

3. Results

3.1 P2X7R expression and activation of SGCs

3.2 Coexpression of GFAP and P2X7R in SGCs in the HGHF environment

3.3 Changes of the Ca2+/p38 MAPK/NF-κB signaling pathway in SGCs

3.4 Expression of TNF-α and IL-1β in SGC in the HGHF environment

3.5 Expression of TRPV1 in neurons after coculture with SGCs

4. Discussion

5. Conclusions

Abbreviations

Declarations

References

Supplementary Files

Status:

Version 1

2.8. Intracellular Ca²⁺ detection

3.3 Changes of the Ca²⁺/p38 MAPK/NF-κB signaling pathway in SGCs