MHE models and treatment
Sprague-Dawley rats (220–250 g) were purchased from the experimental animal center of the Chinese academy of sciences in Shanghai. The normal values of water-finding task (WFT) and Y-maze (YM) of all animals were achieved before experimenting. To induce liver cirrhosis, animals (n = 30) were injected (i.p.) with thioacetamid (TAA) (200 mg/kg in normal saline, Sigma-aldrich) twice per week for 8 weeks. TAA-treated rats were included to the HE group, if they exhibited symptoms of delayed motor activity, lethargy, and subsequent coma [17]. TAA-treated rats with no HE symptoms (n = 22) were conducted to the WFT and YM to confirm MHE condition with the requirements for values of WFT higher than mean ± 1.96·SD or values of YM lower than mean ± 1.96·SD.
Normal and MHE rats were implanted with cannulae in the right lateral ventricles using stereotaxis instrument. MHE rats were intracerebroventricularly microinjected with FGF2 (0.6 µg/10 µl, 1.2 µg/10 µl) or NRG1 (5 µmol/5 µl, 10 µmol/5 µl) through a guide cannula for 3 times one week, or with 0.5 µg of FGF2, NRG1 plasmid or control plasmid pCMV-Tag2A for 24 h (Santa Cruz, CA, USA) [18]. After injection, YM and WFT tests were conducted.
Behavioral tests
For YM, rats were individually put at the end of an arm in a three arm apparatus to explore the maze freely for 8 min. Spontaneous alternation percentage (SA%), defined as a ratio of the arm choices to total choices, were measured [19].
For WFT, Rats were individually put at the near-right corner of the WFT apparatus and allowed to find and drink the water in the alcove within 3 min. Entry latency (EL, the elapsed times for entry into the alcove), contacting latency (CL, the elapsed times for the first touching/sniffing/licking of the water tube) and drinking latency (DL, the elapsed times for the initiation of drinking from the water tube) were measured [20, 21].
Cell culture and treatments
Primary hippocampal rats neurons (PHNs) and Primary cortical rats neurons (PCNs) were obtained from respective hippocampus or cerebral cortex of 1-day-old Sprague-Dawley rat pups which were digested with trypsin and DNase, then plated in poly-L-lysine-precoated six-well plates with a density of 2 × 106 cells/well in Neurobasal® Medium (1X) supplemented with 0.5 mM GlutaMAX™-I, B-27® [22]. Then PHNs or PCNs were treated with FGF2 or NRG1 (1, 5, 20 ng/ml) for 24 h in the presence or absence of 10 µg/ml polyclonal anti-NRG1 antibody (Origene, Rockville, MD), 50 µmol/L ErbB4 inhibitor AG1478 (Origene, Rockville, MD), or 10 µmol/L Sirt1 inhibitor sirtinol (Origene, Rockville, MD) for 24 h, or treated with FGF2 (20 ng/ml) for 24 h after transfection with Silencer Negative Control #1 siRNA (scrambled siRNA), NRG1 or ErbB4 siRNA (0.25 µg, Santa Cruz, CA, USA).
RT-PCR and real-time quantitative PCR (qPCR)
cDNAs templates were synthesized from extracted total RNA using omniscript reverse transcriptase (Quiagen) and used to perform PCR amplification under the indicated conditions using Taq DNA polymerase (Sigma-Aldrich).
Real-time PCR results were normalized to GAPDH mRNA. The primers (Invitrogen) were as follows: NRG1, 5’AATGGACAGCAACACAAG3′ (Forward) and 5’TTAGCGATTACACTAGACAG3′ (Reverse); FGF2, 5’GAAGAGCGACCCTCACATCAAG3′ (Forward) and 5’CTGCCCAGTTCGTTTCAGTG3′ (Reverse); GAPDH, 5′TGTCATCAACGGGAAGCCCA3′ (Forward) and 5’TTGTCATGGATGACCTTGGC3′ (Reverse).
Measurement of FGF2 or NRG1 release
High sensitivity sandwich enzyme-linked immunosorbent assay (ELISA) kits were used to assay Extracellular FGF2 or NRG1 levels in the culture medium of primary neurons in 96-well plates. FGF2 or NRG1 levels were determined spectrophotometrically using a Thermo-Fisher Multiskan MCC plate reader according to the manufacturers’ recommendations.
Immunoblotting (IB) analysis
The amount of protein was prepared from homogenized tissues or tells and determined using the Bradford quantification assay (Bio-Rad). Protein extracts were separated by SDS-PAGE and electroblotted to PVDF membrane (Millipore, Bedford, MA, USA). After blocking with 5% (w/v) non-fat dry milk in PBS, the membrane was probed overnight at 4ºC with primary antibodies (ErbB4, ErbB2, NRG1, FGF2, Sirt1, syntaxin, Homer, or β-actin) (Abcam, Cambridge, UK), and incubated with horseradish peroxidase-conjugated secondary antibodies (Pierce) for 1 h at room temperature. Blots were developed by ECL reagent (Amersham, Arlington Heights, IL, USA), and recorded on Kodak Biomax film.
For coimmunoprecipitations, lysates of tissues or tells were incubated with antibodies overnight (4 °C) and subsequently with protein G-agarose beads (Millipore) for 5 h (4 °C). Beads were washed with lysis buffer, the eluent was separated by SDS-PAGE and electroblotted to PVDF membrane to probe proteins using primary and secondary antibodies.
Functional labeling of presynaptic boutons with FM4-64
5 mg/mL FM4-64 (Invitrogen) and 50 mM KCl in Hanks’ balanced salt solution were used to incubate primary neurons for 1 min at 4 °C. After reaction, free FM4-64 was removed by washing with Hanks’ balanced salt solution.
Double-labeled fluorescent staining
Brain sections or glass coverslips were fixed with 4% paraformaldehyde for 30 min, rupture of cell membrane was performed using 0.1% Triton X-100 for 10 min at room temperature, PBS containing 5% normal goat serum for 1 h at room temperature was used for blocking, and sections or coverslips were incubated overnight at 4 °C with the following primary antibodies: ErbB4, NRG, FGF2, Sirt1, syntaxin, Homer, and MAP2 (Abcam). Alexa Fluor 488 (green)/Alexa Fluor 594 (red) conjugated secondary antibody (Abcam, Cambridge, MA) were then used to detect primary antibodies for 1 h.
For dendritic spine analysis, the primary neurons coverslips were incubated with the primary antibodies: microtubule-associated protein 2B (MAP2B; 1:200; BD Transduction Laboratories, San Jose, CA, USA) and vesicular glutamate transporter 1 (vGlut1; 1:100; Neuromab, Davis, CA, USA) overnight at 4 °C. Alexa Fluor 488 (green)/Alexa Fluor 594 (red) conjugated secondary antibody (Abcam, Cambridge, MA) were then used to detect primary antibodies for 1 h. At least 10 cultured primary neurons per coverslip were used for quantitative analysis.
Statistical analysis
All of the data were indicated as mean ± SD. Data comparisons were determined using one-way analysis of variance (ANOVA). Dunnett’s post hoc multiple comparison test was performed when significant differences were achieved by the ANOVA model. Then P values were adjusted by Bonferroni correction. The level of significance was determined for P < 0.05 or P < 0.01. All analyses were performed with SPSS 18.0 (PASW Statistics 18.0).