Experimental design and feeding management
The basal diet was designed to contain 300 g/kg crude protein with the inclusion of fish meal, soybean meal, rapeseed meal and cottonseed meal as the protein sources. Then, EBE and ELE were supplemented in basal diet (control) with an inclusion of 4 g/kg and 4 g/kg, respectively. EBE and ELE were supplied by Xi’an Huilin Bio-Tech Co., Ltd (Xi’an, China), and 1 kg of EBE and ELE was produced from 5 kg of bark and 10 kg of leaves, respectively. The composition of both extracts is shown in Table 1. The supplemental level of EBE and ELE was calculated by referring to the studies of Sun et al. [9] and Leng et al. [26], respectively. In addition, Y2O3 was used as marker to measure the digestibility. All ingredients were ground, sifted, mixed and pelleted as described by Sun et al. [22], and then all diets were air-dried and stored at 4 ℃ until use. The ingredients and proximate composition of experimental diets are shown in Table 2.
Table 1
The composition of Eucommia extracts (g/kg)
Parameters | EBE | ELE |
Total phenolic acids | 50.1 | 85.8 |
Total flavonoids | 36.3 | 95.4 |
Total polysaccharides | 81.0 | 112.3 |
Table 2
Ingredients and proximate composition of experimental diets (g/kg)
Ingredints | Control | EBE | ELE |
Fish meal | 20.0 | 20.0 | 20.0 |
Soybean meal | 180.0 | 180.0 | 180.0 |
Cottonseed meal | 150.0 | 150.0 | 150.0 |
Rapeseed meal | 190.0 | 190.0 | 190.0 |
Wheat bran | 102.5 | 98.5 | 98.5 |
Defatted rice bran | 100.0 | 100.0 | 100.0 |
Wheat middling | 220.0 | 220.0 | 220.0 |
Soybean oil | 10.0 | 10.0 | 10.0 |
Ca(H2PO4)2 | 15.0 | 15.0 | 15.0 |
Vitamin premix | 2.0 | 2.0 | 2.0 |
Choline chloride (500 g/kg) | 5.0 | 5.0 | 5.0 |
Mineral premix | 5.0 | 5.0 | 5.0 |
Y2O3 | 0.5 | 0.5 | 0.5 |
EBE | - | 4.0 | - |
ELE | - | - | 4.0 |
Total | 1000.0 | 1000.0 | 1000.0 |
Proximate composition | | | |
Moisture | 94.2 | 93.5 | 94.5 |
Crude protein | 300.4 | 302.2 | 299.5 |
Crude lipid | 42.9 | 42.7 | 43.2 |
Crude ash | 70.4 | 69.8 | 69.8 |
EBE, Eucommia bark extract; ELE, Eucommia leaf extract |
The ingredients were purchased from the Yuehai Feed Company (Zhejiang, China), and the protein contents of ingredients are as follow: fish meal (630.0 g/kg), soybean meal (442.0 g/kg), cottonseed meal (500.0 g/kg), rapeseed meal (377.0 g/kg), wheat middling (169.0 g/kg), defatted rice bran (143.0 g/kg). |
Vitatim premix (mg or IU/kg diet): VA, 10 000 IU; VD3, 3 000 IU; VE 150 IU; VK3, 12.17 mg; VB1, 20 mg; VB2, 20 mg; VB3, 100 mg; VB6, 22 mg; VB12, 0.15 mg; VC, 1000 mg; biotin, 0.6 mg; folic acid, 8 mg; inositol, 500 mg. |
Mineral premix (mg/kg diet): I, 1.5 mg; Co, 0.6 mg; Cu, 3 mg; Fe, 63 mg; Zn, 89 mg; Mn, 11.45 mg; Se, 0.24 mg; Mg, 180 mg. |
Grass carp were obtained from Jinshan Aquaculture Farm (Shanghai, China). One hundred and sixty-two grass carp with an average initial weight of 59.7 ± 0.2 g were randomly distributed into 9 cages (1.5 × 1.0 × 1.2 m) with 18 fish per cage. During the experimental period, the fish were fed with a daily feeding rate of 3–5% of body weight with three meals (7:00, 12:00, 17:00) per day for 60 days. The feed intake of all cages was appropriately adjusted according to water temperature, and maintained with a similar amount to ensure no feed residue left. The waste in the pools was cleared by siphoning every 5 days, and 1/3 cultured water was renewed with pond water. The dissolved oxygen was not less than 5 mg/L, and water temperature and pH were maintained at 27 ± 2℃ and 7.7 ± 0.2, respectively. The feeding experiment was conducted at Binhai Aquaculture Station (Shanghai, China).
Sample Collection And Analysis
Growth performance and physical indices
When the feeding trial ended, all fish were starved for 24 h, and measured total final body weight to calculate weight gain (WG) and feed conversion ratio (FCR). Three fish per cage were randomly selected and anesthetized with MS-222 (30 mg/L) to individually measure body weight, body length, liver weight, visceral weight and mesenteric lipid weight, then the indices of condition factor (K), hepato-somatic index (HSI), viscero-somatic index (VSI) and mesenteric lipid-somatic index (MSI) were calculated as follows:
Weight gain (WG, %) = 100×[final weight- initial weight ]/initial weight
Feed conversion ratio (FCR) = feed intake /wet weight gain
Condition factor (K, g/cm3) = 100×[body weight (g)/body length (cm3)]
Viscero-somatic index (VSI, %) = 100×[visceral weight/body weight]
Hepato-somatic index (HSI, %) = 100×[liver weight /body weight]
Mesenteric lipid-somatic index (MSI, %) = 100 × Mesenteric fat weight/final weight
Water holding capacity of flesh
Five blocks of flesh (about 3 g) were sampled from the dorsal muscle of the left side of the body per fish to determine water-holding capacity (WHC) immediately as follows:
The first and second flesh sample (W1) was steaming in pot for 5 min or centrifuging at 3 500 r/min for 10 min, then wiped off the surface liquid and weighed (W2) to calculate steaming loss and centrifugal loss. The other three flesh sample (W1) at 4℃ for 6, 12 and 24 h, respectively, then wiped off the surface liquid and weighed (W2) to calculate drip loss.
Steaming (centrifugal, drip) loss (%) = 100×(W1-W2)/W1
Flesh And Diets Proximate Composition
The rest of dorsal muscle was stored at -20 °C for the analysis of crude protein, crude lipid, crude ash, moisture, calcium, phosphorus, total collagen, heat-soluble collagen, free amino acids and fatty acid composition.
The proximate composition in flesh (moisture, crude lipid, crude protein and crude ash) was analyzed according to AOAC [27] methods described in our previous study [22]. The calcium, phosphorus content was determined by methylthymol blue colorimetry and phosphomolybdic acid colorimetry.
Total collagen content were calculated by multiplying the hydroxyproline content by 8 [22], and the hydroxyproline test kits were supplied by Nanjing Jiancheng Bioengineering Institute (Nanjing, China). Heat-soluble collagen was determined according to the method of Kong et al. [28]. Muscle sample (2 g) was homogenized with four times Ringer's solution (0.86% NaCl, 0.03% KCl, and 0.033% CaCl2) (10 000 rpm, 1 min), then the homogenate was heated at 77 °C for 70 min and centrifuged (12 000 r/min) for 30 min at 4 °C. The extraction was repeated twice with supernatants combined. The collagen content of supernatants was measured as heat-soluble collagen.
Heat-insoluble collagen = Total collagen - Heat-soluble collagen
For determination of free amino acid in muscle, samples were homogenized with 30 volumes of extract liquid (Methanol:water = 4:1) and centrifuged at 12 000 r/min and 4 °C for 30 min. The supernatants were analyzed using Ultra Performance Liquid Chromatography, UPLC (Waters Acquity, USA). The fatty acids composition of the muscle was determined with Boron trifluoride method according to the description of Zuo et al. [29] with GC-MS (7890B gas chromatograph- mass spectrometer, Agilents Technologies, USA).
Antioxidant Capacity Of Flesh
The muscle samples were thawed at 4 °C, and then homogenized with four times ice-cold distilled water at 4 °C and centrifuged for 10 min (6 000 r/min). The supernatant was preserved at 4 °C, and determined antioxidation index in 24 hr. Lactic acid (LC), malondialdehyde (MDA), protein carbonyl (PC), catalase (CAT), superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px) were measured by kits (Shanghai Haling Biotechnology Co., Ltd, Shanghai, China)
The Histology Of Flesh
Muscle samples were immersed in 4% methanol solution for at least 48 hr. The tissue was dehydrated, paraffin-embedded, sectioned (8 µm), stained (Picrosirius Red) and sealed with a neutral gum. The collagen distribution in flesh was observed using an imaging microscope (Nikon YS100).
Digestive Enzyme Activity
The anterior intestine was sampled from three fish per cage after they were dissected on ice, and then stored at -80 °C until use. The 2.0 g samples were thawed at 4 °C, and then homogenized with 8.0 ml ice-cold distilled water at 4 °C and centrifuged for 10 min (6 000 r/min). The supernatant was collected and preserved at 4 °C until the use in 24 hr.
The measurement of amylase activity and soluble protein concentration were used by kits (Nanjing Jiancheng Bioengineering Institute) with iodine-starch colorimetric method and Coomassie brilliant blue method, respectively, and protease activity was analyzed by Folin-Ciocalteu method. The methods were referred to the description of Yang et al. [30].
Digestibility
After the sampling, all fish continued to keep their original feeds for one week, then the intact faeces was siphoned 2 hr after feeding and stored at -20 °C for analysis. Yttrium contents in diets and faeces were analyzed using inductively coupled plasma (ICP) emission spectroscopy (Vista MPX; Varian). Faeces protein was measured as the above method (2.2.3). Apparent digestibility coefficient (ADC) of dry matter (DM) and crude protein (CP) was calculated as follows:
ADC of DM = [1-DietaryY2O3/FaecalY2O3] × 100%
ADC of CP = [1- (Faecal CP/Dietary CP × Dietary Y2O3/FaecalY2O3)] × 100%
Real time quantitative PCR analysis of gene expression in flesh
Total RNA was isolated from muscle samples using an RNAiso Plus Kit (Takara, Dalian, China) and assessed by agarose gel electrophoresis and by spectrophotometric analysis. Subsequently, cDNA synthesis was performed using the PrimeScriptTM RT reagent Kit (Takara, Dalian, China), and then was stored at − 80 ℃ until use. Based on the sequence of grass carp 18S (EU047719.1) and type Ⅰ collagen (COL1A1, COL1A2), matrix metalloproteinase-2 (MMP-2) and matrix metalloproteinase-9 (MMP-9) in GenBank, and the cloned lysine oxidase (LOX) and proline hydroxylase (PHD) sequence of full length cDNA (they will be published separately) in our laboratory, the PCR primers were designed (Table 3). All real-time quantitative PCR analysis was performed using the SYBR® Premix Ex Taq (Perfect Real‐Time) kit (TaKaRa) according to the manufacturer's instructions. The total reaction volume was 20 µl, containing 10 µl SYBR® Premix Ex Taq™ (Tli RNaseH Plus), 0.5 µl upstream primer, 0.5 µl downstream primer, 1 µl cDNA template and 8 µl ddH2O. The thermocycling conditions of real‐time PCR were presented as follows: denaturing at 95 °C for 3 min and 39 cycles of denaturing at 95 °C for 5 s, annealing at 60 °C for 10 s and extension at 72 °C for 30 s, then the melting curve was created after the extension. The expression results of COL1A1, COL1A2, PHD, LOX, MMP-2 and MMP-9 in flesh was calculated using the 2−△△Ct method.
Table 3
The primer for real-time PCR
Primer name | Sequence from 5′ to 3′ | usage |
18srRNA-F | GGAATGAGCGTATCCTAAACCC | qRT-PCR |
18srRNA-R | CTCCCGAGATCCAACTACAAGC | qRT-PCR |
COL1A1-F | ACGCACACAAACAATCTCAAGT | qRT-PCR |
COL1A1-R | GCATGGGGCAAGACAGTCA | qRT-PCR |
COL1A2-F | ACTCCGATAGAGCCCAGCTT | qRT-PCR |
COL1A2-R | ACATTGGTGGCGCAGATCA | qRT-PCR |
LOX-F | GTTATCAGGTGGCGATGGAG | qRT-PCR |
LOX-R | GTAGACTCGTATGGGTTGTAAGG | qRT-PCR |
PHD-F | CTCGAAACCCAACGGACAGA | qRT-PCR |
PHD-R | AGCTGTCCGTCTGTAAAGCC | qRT-PCR |
MMP2-F | GAGCTGTGGACATTAGGAGAAG | qRT-PCR |
MMP2-R | GAACAAGAGCTCATGAGGACAG | qRT-PCR |
MMP9-F | ACTTGGAGTTGTGGCTTTTC | qRT-PCR |
MMP9-R | AGGGCTCTGTCATCAGGTTA | qRT-PCR |
Statistical analysis
The experimental data were carried out using SPSS 22.0 software, and presented as the mean ± standard deviation (SD). All data were subjected to a one-way analysis of variance (ANOVA), and combined with Duncan's multiple range test to identify the differences among treatments. The significance level for differences was determined at P < 0.05.